FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628811_at:

>probe:Drosophila_2:1628811_at:680:77; Interrogation_Position=1020; Antisense; AGGATAATATTGTCTGCCTTCCGGC
>probe:Drosophila_2:1628811_at:139:1; Interrogation_Position=1057; Antisense; ACCTTACGTCCGCAATTGTCCAATT
>probe:Drosophila_2:1628811_at:44:375; Interrogation_Position=1129; Antisense; GAAGTAGTCTTTTATGCAGCCCCTG
>probe:Drosophila_2:1628811_at:712:211; Interrogation_Position=1169; Antisense; AAGACTCCCAATTGCATTGCACGTA
>probe:Drosophila_2:1628811_at:698:377; Interrogation_Position=1215; Antisense; GAACCCTTTTCGTGTTTTGCAATTG
>probe:Drosophila_2:1628811_at:245:539; Interrogation_Position=1239; Antisense; GGTAGTCTTAGCAGCCAAAGCAAAT
>probe:Drosophila_2:1628811_at:578:391; Interrogation_Position=745; Antisense; GAAAGCCCCGCAACATCAATTGTGC
>probe:Drosophila_2:1628811_at:167:535; Interrogation_Position=778; Antisense; GGTGCCATTGGTTTATCATTTGTAC
>probe:Drosophila_2:1628811_at:425:545; Interrogation_Position=814; Antisense; GGATCAGGAGTCTACCGCCAGGAGC
>probe:Drosophila_2:1628811_at:362:75; Interrogation_Position=833; Antisense; AGGAGCAATCAGGTGTCCCGGTCGT
>probe:Drosophila_2:1628811_at:667:535; Interrogation_Position=852; Antisense; GGTCGTCTTCAAGGCATGCAACTGC
>probe:Drosophila_2:1628811_at:189:107; Interrogation_Position=890; Antisense; AGACAATCCACTTCTTACAGCATGC
>probe:Drosophila_2:1628811_at:265:249; Interrogation_Position=940; Antisense; CAATCCTACGCGGTTTAATCAGAAC
>probe:Drosophila_2:1628811_at:636:113; Interrogation_Position=989; Antisense; AGCAGCTCATCTAGATCTTCTAACC

Paste this into a BLAST search page for me
AGGATAATATTGTCTGCCTTCCGGCACCTTACGTCCGCAATTGTCCAATTGAAGTAGTCTTTTATGCAGCCCCTGAAGACTCCCAATTGCATTGCACGTAGAACCCTTTTCGTGTTTTGCAATTGGGTAGTCTTAGCAGCCAAAGCAAATGAAAGCCCCGCAACATCAATTGTGCGGTGCCATTGGTTTATCATTTGTACGGATCAGGAGTCTACCGCCAGGAGCAGGAGCAATCAGGTGTCCCGGTCGTGGTCGTCTTCAAGGCATGCAACTGCAGACAATCCACTTCTTACAGCATGCCAATCCTACGCGGTTTAATCAGAACAGCAGCTCATCTAGATCTTCTAACC

Full Affymetrix probeset data:

Annotations for 1628811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720