FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628813_at:

>probe:Drosophila_2:1628813_at:703:23; Interrogation_Position=1009; Antisense; ATAGTTACAAGCTGCCAGGCCCAGA
>probe:Drosophila_2:1628813_at:702:99; Interrogation_Position=1058; Antisense; AGATGGCTTGGAACTCCTACGCAAT
>probe:Drosophila_2:1628813_at:25:663; Interrogation_Position=1096; Antisense; TAAAGTTAGTCACTCGCCGATACTC
>probe:Drosophila_2:1628813_at:10:9; Interrogation_Position=1151; Antisense; ATTCCTGGCCAGCAAAGATCGTCAA
>probe:Drosophila_2:1628813_at:546:97; Interrogation_Position=1166; Antisense; AGATCGTCAAGTGCCGGATCTCTAC
>probe:Drosophila_2:1628813_at:63:545; Interrogation_Position=1181; Antisense; GGATCTCTACGAACTGGACACCAGT
>probe:Drosophila_2:1628813_at:210:263; Interrogation_Position=1213; Antisense; CAGCTTGGCAGGTGGCAGTCTACAA
>probe:Drosophila_2:1628813_at:481:665; Interrogation_Position=1233; Antisense; TACAAGCGGGCAGAGACCATCATAG
>probe:Drosophila_2:1628813_at:96:213; Interrogation_Position=1273; Antisense; AAGAGGCTTGCGAGATACTACCAAT
>probe:Drosophila_2:1628813_at:417:145; Interrogation_Position=1289; Antisense; ACTACCAATGGCCAAGCGGGAGCAT
>probe:Drosophila_2:1628813_at:443:551; Interrogation_Position=1334; Antisense; GGAGACTAGCCATTTTTGTCAAATA
>probe:Drosophila_2:1628813_at:616:51; Interrogation_Position=1467; Antisense; ATGCTCTCAACGGATCTAGCGAAGA
>probe:Drosophila_2:1628813_at:156:561; Interrogation_Position=1518; Antisense; GGAAAGGCGGAGACTCAGCCACCAC
>probe:Drosophila_2:1628813_at:586:435; Interrogation_Position=990; Antisense; GAGGAGTACCTCAAAACCCATAGTT

Paste this into a BLAST search page for me
ATAGTTACAAGCTGCCAGGCCCAGAAGATGGCTTGGAACTCCTACGCAATTAAAGTTAGTCACTCGCCGATACTCATTCCTGGCCAGCAAAGATCGTCAAAGATCGTCAAGTGCCGGATCTCTACGGATCTCTACGAACTGGACACCAGTCAGCTTGGCAGGTGGCAGTCTACAATACAAGCGGGCAGAGACCATCATAGAAGAGGCTTGCGAGATACTACCAATACTACCAATGGCCAAGCGGGAGCATGGAGACTAGCCATTTTTGTCAAATAATGCTCTCAACGGATCTAGCGAAGAGGAAAGGCGGAGACTCAGCCACCACGAGGAGTACCTCAAAACCCATAGTT

Full Affymetrix probeset data:

Annotations for 1628813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720