Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628814_s_at:

>probe:Drosophila_2:1628814_s_at:363:225; Interrogation_Position=308; Antisense; AAGGAATCCGTGAAAGGCACCAAGA
>probe:Drosophila_2:1628814_s_at:49:355; Interrogation_Position=324; Antisense; GCACCAAGAGGCCAGCAGAAGCCAA
>probe:Drosophila_2:1628814_s_at:447:351; Interrogation_Position=338; Antisense; GCAGAAGCCAAATCCGCAGAATCAA
>probe:Drosophila_2:1628814_s_at:242:47; Interrogation_Position=349; Antisense; ATCCGCAGAATCAAAGAAGGCCAAG
>probe:Drosophila_2:1628814_s_at:160:287; Interrogation_Position=381; Antisense; CGGCCGCCGATGGAGATTCCGATGA
>probe:Drosophila_2:1628814_s_at:281:375; Interrogation_Position=407; Antisense; GAAGAGGCTCTGGAGGAAATCATCG
>probe:Drosophila_2:1628814_s_at:522:35; Interrogation_Position=425; Antisense; ATCATCGAGGGCGACAGTGAAATCG
>probe:Drosophila_2:1628814_s_at:60:325; Interrogation_Position=435; Antisense; GCGACAGTGAAATCGAGAGCGACGA
>probe:Drosophila_2:1628814_s_at:192:425; Interrogation_Position=449; Antisense; GAGAGCGACGAGTACGACATCCCCT
>probe:Drosophila_2:1628814_s_at:307:137; Interrogation_Position=462; Antisense; ACGACATCCCCTACGATGGTGAGGA
>probe:Drosophila_2:1628814_s_at:730:655; Interrogation_Position=520; Antisense; TAATGATGACGGTTCCGGCTCGGAC
>probe:Drosophila_2:1628814_s_at:116:715; Interrogation_Position=532; Antisense; TTCCGGCTCGGACGATCAGGCGTAA
>probe:Drosophila_2:1628814_s_at:220:647; Interrogation_Position=547; Antisense; TCAGGCGTAATAATAATGTAGTCAA
>probe:Drosophila_2:1628814_s_at:234:241; Interrogation_Position=844; Antisense; AATTGAAGGCATTTTCGTATAAACG

Paste this into a BLAST search page for me
AAGGAATCCGTGAAAGGCACCAAGAGCACCAAGAGGCCAGCAGAAGCCAAGCAGAAGCCAAATCCGCAGAATCAAATCCGCAGAATCAAAGAAGGCCAAGCGGCCGCCGATGGAGATTCCGATGAGAAGAGGCTCTGGAGGAAATCATCGATCATCGAGGGCGACAGTGAAATCGGCGACAGTGAAATCGAGAGCGACGAGAGAGCGACGAGTACGACATCCCCTACGACATCCCCTACGATGGTGAGGATAATGATGACGGTTCCGGCTCGGACTTCCGGCTCGGACGATCAGGCGTAATCAGGCGTAATAATAATGTAGTCAAAATTGAAGGCATTTTCGTATAAACG

Full Affymetrix probeset data:

Annotations for 1628814_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime