Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628815_at:

>probe:Drosophila_2:1628815_at:280:145; Interrogation_Position=5168; Antisense; ACTTAGCTTCTTCTCTAAACTGCGA
>probe:Drosophila_2:1628815_at:602:585; Interrogation_Position=5298; Antisense; TGGAAATTGTGCTCCCTATGCGAAT
>probe:Drosophila_2:1628815_at:446:597; Interrogation_Position=5305; Antisense; TGTGCTCCCTATGCGAATCATTTAG
>probe:Drosophila_2:1628815_at:246:391; Interrogation_Position=5341; Antisense; GAAACTATTTGCATTCCATACGAAT
>probe:Drosophila_2:1628815_at:209:369; Interrogation_Position=5362; Antisense; GAATGCCCCACTGAAACGATCGATA
>probe:Drosophila_2:1628815_at:230:459; Interrogation_Position=5383; Antisense; GATATCATTTGTCTTGCACTCGCAT
>probe:Drosophila_2:1628815_at:483:179; Interrogation_Position=5421; Antisense; AAACATTCTGCTGTTTCCATTCGCA
>probe:Drosophila_2:1628815_at:79:481; Interrogation_Position=5433; Antisense; GTTTCCATTCGCACAATAGTTCTAA
>probe:Drosophila_2:1628815_at:382:21; Interrogation_Position=5457; Antisense; ATTTGGACATTTTGCGCGTTTGAGC
>probe:Drosophila_2:1628815_at:323:327; Interrogation_Position=5472; Antisense; GCGTTTGAGCGCATTAGCAAATCAT
>probe:Drosophila_2:1628815_at:346:599; Interrogation_Position=5532; Antisense; TGTATTTCATTTGTACGTTCCGTTT
>probe:Drosophila_2:1628815_at:178:221; Interrogation_Position=5559; Antisense; AAGTGATTTGTATCTGTACGTCTAA
>probe:Drosophila_2:1628815_at:607:253; Interrogation_Position=5594; Antisense; CAACTGTTTTTGTAATTGCCTTATA
>probe:Drosophila_2:1628815_at:68:479; Interrogation_Position=5675; Antisense; GTTTATCCGGCGTTAGCTGTCTATA

Paste this into a BLAST search page for me
ACTTAGCTTCTTCTCTAAACTGCGATGGAAATTGTGCTCCCTATGCGAATTGTGCTCCCTATGCGAATCATTTAGGAAACTATTTGCATTCCATACGAATGAATGCCCCACTGAAACGATCGATAGATATCATTTGTCTTGCACTCGCATAAACATTCTGCTGTTTCCATTCGCAGTTTCCATTCGCACAATAGTTCTAAATTTGGACATTTTGCGCGTTTGAGCGCGTTTGAGCGCATTAGCAAATCATTGTATTTCATTTGTACGTTCCGTTTAAGTGATTTGTATCTGTACGTCTAACAACTGTTTTTGTAATTGCCTTATAGTTTATCCGGCGTTAGCTGTCTATA

Full Affymetrix probeset data:

Annotations for 1628815_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime