FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628818_at:

>probe:Drosophila_2:1628818_at:4:9; Interrogation_Position=1086; Antisense; ATTCGACATGCTCTCGATGGACGCA
>probe:Drosophila_2:1628818_at:678:253; Interrogation_Position=1112; Antisense; CAACTGCCCGCTGACAAAGATGATA
>probe:Drosophila_2:1628818_at:135:59; Interrogation_Position=1131; Antisense; ATGATATGGTATCCCTTCATCCACT
>probe:Drosophila_2:1628818_at:667:667; Interrogation_Position=1215; Antisense; TACTTTTTTGACCTGGCTCTCTGGC
>probe:Drosophila_2:1628818_at:235:425; Interrogation_Position=1241; Antisense; GAGTGGCCGGAAGCCCAGACTAGTA
>probe:Drosophila_2:1628818_at:93:173; Interrogation_Position=1277; Antisense; AAAGATCCACAAGACTCTCGGCATC
>probe:Drosophila_2:1628818_at:279:51; Interrogation_Position=1338; Antisense; ATGCGGAATACGGATCACTTGAGGC
>probe:Drosophila_2:1628818_at:718:457; Interrogation_Position=1401; Antisense; GATATGGTCAGCCTCAACTGGAAGG
>probe:Drosophila_2:1628818_at:202:365; Interrogation_Position=1425; Antisense; GAATACTTCGTTCAAGCTCTGCGTG
>probe:Drosophila_2:1628818_at:21:699; Interrogation_Position=1523; Antisense; TTTAAAGCTGCTCCATCATATCCTG
>probe:Drosophila_2:1628818_at:634:251; Interrogation_Position=1548; Antisense; CAAGGTGTCCTTTGCTTTGTGGCAC
>probe:Drosophila_2:1628818_at:544:729; Interrogation_Position=1564; Antisense; TTGTGGCACTACTAGCACTGTGGTC
>probe:Drosophila_2:1628818_at:683:657; Interrogation_Position=1594; Antisense; TAAGGATCCTAGTCTGATTCAGCAG
>probe:Drosophila_2:1628818_at:545:403; Interrogation_Position=1636; Antisense; GACTCACTTTCGTAATTGCGTCATG

Paste this into a BLAST search page for me
ATTCGACATGCTCTCGATGGACGCACAACTGCCCGCTGACAAAGATGATAATGATATGGTATCCCTTCATCCACTTACTTTTTTGACCTGGCTCTCTGGCGAGTGGCCGGAAGCCCAGACTAGTAAAAGATCCACAAGACTCTCGGCATCATGCGGAATACGGATCACTTGAGGCGATATGGTCAGCCTCAACTGGAAGGGAATACTTCGTTCAAGCTCTGCGTGTTTAAAGCTGCTCCATCATATCCTGCAAGGTGTCCTTTGCTTTGTGGCACTTGTGGCACTACTAGCACTGTGGTCTAAGGATCCTAGTCTGATTCAGCAGGACTCACTTTCGTAATTGCGTCATG

Full Affymetrix probeset data:

Annotations for 1628818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720