FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628819_at:

>probe:Drosophila_2:1628819_at:307:585; Interrogation_Position=14; Antisense; TGGAAGGACGCCAACCGGAGCGCCA
>probe:Drosophila_2:1628819_at:514:675; Interrogation_Position=152; Antisense; TAGTCATTCCACGTAGGCATTCTCC
>probe:Drosophila_2:1628819_at:144:73; Interrogation_Position=166; Antisense; AGGCATTCTCCTCGTGTTGTCAGGA
>probe:Drosophila_2:1628819_at:177:361; Interrogation_Position=181; Antisense; GTTGTCAGGAGTCTCGGTTCTGCCT
>probe:Drosophila_2:1628819_at:722:193; Interrogation_Position=218; Antisense; AACTGACATGTCTGGCATATGCAAA
>probe:Drosophila_2:1628819_at:709:615; Interrogation_Position=237; Antisense; TGCAAAATGCCAACTGTCCTGGCCA
>probe:Drosophila_2:1628819_at:336:275; Interrogation_Position=304; Antisense; CTTCGTTTGGCTGTTGTTTTTGTCA
>probe:Drosophila_2:1628819_at:256:81; Interrogation_Position=338; Antisense; AGGGCAAGGACACTACACCAAGTGC
>probe:Drosophila_2:1628819_at:43:187; Interrogation_Position=364; Antisense; AACAAGGTGATGCTCCAGCTGGCAA
>probe:Drosophila_2:1628819_at:166:447; Interrogation_Position=372; Antisense; GATGCTCCAGCTGGCAAACATACCA
>probe:Drosophila_2:1628819_at:694:183; Interrogation_Position=400; Antisense; AACAAGACGAATACGCAGTGGGCGG
>probe:Drosophila_2:1628819_at:188:123; Interrogation_Position=52; Antisense; AGCGTCTTGTGCTCCTCCTCAGAAT
>probe:Drosophila_2:1628819_at:253:111; Interrogation_Position=72; Antisense; AGAATCCTGCTCATCGCTGAGCAAT
>probe:Drosophila_2:1628819_at:63:421; Interrogation_Position=97; Antisense; GAGAAGGCTACAGCTTTGTTCCCTG

Paste this into a BLAST search page for me
TGGAAGGACGCCAACCGGAGCGCCATAGTCATTCCACGTAGGCATTCTCCAGGCATTCTCCTCGTGTTGTCAGGAGTTGTCAGGAGTCTCGGTTCTGCCTAACTGACATGTCTGGCATATGCAAATGCAAAATGCCAACTGTCCTGGCCACTTCGTTTGGCTGTTGTTTTTGTCAAGGGCAAGGACACTACACCAAGTGCAACAAGGTGATGCTCCAGCTGGCAAGATGCTCCAGCTGGCAAACATACCAAACAAGACGAATACGCAGTGGGCGGAGCGTCTTGTGCTCCTCCTCAGAATAGAATCCTGCTCATCGCTGAGCAATGAGAAGGCTACAGCTTTGTTCCCTG

Full Affymetrix probeset data:

Annotations for 1628819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720