FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628820_at:

>probe:Drosophila_2:1628820_at:447:489; Interrogation_Position=1025; Antisense; GTACGGCAGCAACTACCAGGGCTAT
>probe:Drosophila_2:1628820_at:719:673; Interrogation_Position=1038; Antisense; TACCAGGGCTATCAGAGCCAGCACT
>probe:Drosophila_2:1628820_at:481:313; Interrogation_Position=1054; Antisense; GCCAGCACTCCAACGCGAATATGTA
>probe:Drosophila_2:1628820_at:475:365; Interrogation_Position=1070; Antisense; GAATATGTACAACAAGCCGCCGCCG
>probe:Drosophila_2:1628820_at:172:593; Interrogation_Position=1177; Antisense; TGGGTATGCCCGTCCTAATCTTGGG
>probe:Drosophila_2:1628820_at:166:69; Interrogation_Position=647; Antisense; AGGCGCCTCCTCGACGGGCGTAATA
>probe:Drosophila_2:1628820_at:534:407; Interrogation_Position=659; Antisense; GACGGGCGTAATAGATCCGCACTAC
>probe:Drosophila_2:1628820_at:268:25; Interrogation_Position=669; Antisense; ATAGATCCGCACTACGTGTTCGGTG
>probe:Drosophila_2:1628820_at:411:513; Interrogation_Position=684; Antisense; GTGTTCGGTGCCAAGCACCACATGC
>probe:Drosophila_2:1628820_at:243:479; Interrogation_Position=764; Antisense; GTTTCAGCAGTTTCCTCAACCCAAT
>probe:Drosophila_2:1628820_at:652:607; Interrogation_Position=832; Antisense; TGCAGCCGGTGAACCCGTACAATCC
>probe:Drosophila_2:1628820_at:32:39; Interrogation_Position=864; Antisense; ATCTTTGGCCAGCTGCCATTCTATG
>probe:Drosophila_2:1628820_at:532:449; Interrogation_Position=966; Antisense; GTCGGACTGCCCAGTTCGACCTTGG
>probe:Drosophila_2:1628820_at:11:637; Interrogation_Position=981; Antisense; TCGACCTTGGGCATCCTCGGCGGCG

Paste this into a BLAST search page for me
GTACGGCAGCAACTACCAGGGCTATTACCAGGGCTATCAGAGCCAGCACTGCCAGCACTCCAACGCGAATATGTAGAATATGTACAACAAGCCGCCGCCGTGGGTATGCCCGTCCTAATCTTGGGAGGCGCCTCCTCGACGGGCGTAATAGACGGGCGTAATAGATCCGCACTACATAGATCCGCACTACGTGTTCGGTGGTGTTCGGTGCCAAGCACCACATGCGTTTCAGCAGTTTCCTCAACCCAATTGCAGCCGGTGAACCCGTACAATCCATCTTTGGCCAGCTGCCATTCTATGGTCGGACTGCCCAGTTCGACCTTGGTCGACCTTGGGCATCCTCGGCGGCG

Full Affymetrix probeset data:

Annotations for 1628820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720