FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628821_at:

>probe:Drosophila_2:1628821_at:45:549; Interrogation_Position=1138; Antisense; GGAGGCGTGGTAACACATCCCTTTG
>probe:Drosophila_2:1628821_at:437:305; Interrogation_Position=1157; Antisense; CCTTTGGCGGACCATTCGACATAAT
>probe:Drosophila_2:1628821_at:232:635; Interrogation_Position=1172; Antisense; TCGACATAATGAAGCCGGATCTAAT
>probe:Drosophila_2:1628821_at:315:39; Interrogation_Position=1195; Antisense; ATCTGCGCCGGCACAGAGAAGTTGC
>probe:Drosophila_2:1628821_at:376:75; Interrogation_Position=1223; Antisense; AGGAGATCGAAGACCTTCTGCGTAA
>probe:Drosophila_2:1628821_at:724:697; Interrogation_Position=1294; Antisense; TTTAGGCAAGGCAACAACGATCTTA
>probe:Drosophila_2:1628821_at:69:537; Interrogation_Position=1333; Antisense; GGTCAGCTGCACTGCCAATTGGCGC
>probe:Drosophila_2:1628821_at:413:21; Interrogation_Position=1387; Antisense; ATATATTCCAGCTTTAATCGCCGGC
>probe:Drosophila_2:1628821_at:394:701; Interrogation_Position=1400; Antisense; TTAATCGCCGGCAGCTGTTCCACGA
>probe:Drosophila_2:1628821_at:60:121; Interrogation_Position=1412; Antisense; AGCTGTTCCACGATACACGTCAAAA
>probe:Drosophila_2:1628821_at:529:329; Interrogation_Position=1439; Antisense; GCGGGAAAGCCCGTCAATCTTGAGA
>probe:Drosophila_2:1628821_at:173:657; Interrogation_Position=1498; Antisense; TAAGCATTTAGCTGGCAAACAACTT
>probe:Drosophila_2:1628821_at:608:685; Interrogation_Position=1525; Antisense; TATACAGATTACCTACTTGGAAATT
>probe:Drosophila_2:1628821_at:199:129; Interrogation_Position=1600; Antisense; ACCTTTTTCATATAGCATCCCTCAG

Paste this into a BLAST search page for me
GGAGGCGTGGTAACACATCCCTTTGCCTTTGGCGGACCATTCGACATAATTCGACATAATGAAGCCGGATCTAATATCTGCGCCGGCACAGAGAAGTTGCAGGAGATCGAAGACCTTCTGCGTAATTTAGGCAAGGCAACAACGATCTTAGGTCAGCTGCACTGCCAATTGGCGCATATATTCCAGCTTTAATCGCCGGCTTAATCGCCGGCAGCTGTTCCACGAAGCTGTTCCACGATACACGTCAAAAGCGGGAAAGCCCGTCAATCTTGAGATAAGCATTTAGCTGGCAAACAACTTTATACAGATTACCTACTTGGAAATTACCTTTTTCATATAGCATCCCTCAG

Full Affymetrix probeset data:

Annotations for 1628821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720