FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628822_at:

>probe:Drosophila_2:1628822_at:82:589; Interrogation_Position=1449; Antisense; TGGATGAGCCGGAGAGCAACGCTAA
>probe:Drosophila_2:1628822_at:14:321; Interrogation_Position=1496; Antisense; GCCGCCATGTCCGTCGAAGAAAGGG
>probe:Drosophila_2:1628822_at:280:155; Interrogation_Position=1561; Antisense; ACAGATGGGCGTGCTCTAAGTGTCC
>probe:Drosophila_2:1628822_at:327:655; Interrogation_Position=1577; Antisense; TAAGTGTCCGCAAACGTTTTGTAGT
>probe:Drosophila_2:1628822_at:75:13; Interrogation_Position=1604; Antisense; ATTCACGTTTGTTGTGTGTGCCGTT
>probe:Drosophila_2:1628822_at:253:517; Interrogation_Position=1619; Antisense; GTGTGCCGTTTGCTCAACCCATTTA
>probe:Drosophila_2:1628822_at:200:133; Interrogation_Position=1643; Antisense; ACCCCTCTTCAATGTGAACCTCTAA
>probe:Drosophila_2:1628822_at:470:493; Interrogation_Position=1713; Antisense; GTAATATACCAATCTGCTGCAGCCA
>probe:Drosophila_2:1628822_at:2:39; Interrogation_Position=1724; Antisense; ATCTGCTGCAGCCAGGCACTCAAAT
>probe:Drosophila_2:1628822_at:111:357; Interrogation_Position=1739; Antisense; GCACTCAAATTCCATTCATTCCAAT
>probe:Drosophila_2:1628822_at:538:273; Interrogation_Position=1755; Antisense; CATTCCAATTTGTTTTACCACTGCA
>probe:Drosophila_2:1628822_at:39:701; Interrogation_Position=1767; Antisense; TTTTACCACTGCAAGAGCCACAGCA
>probe:Drosophila_2:1628822_at:654:319; Interrogation_Position=1807; Antisense; GCCGCAACCCAATCAGCAGCAAAAT
>probe:Drosophila_2:1628822_at:399:651; Interrogation_Position=1847; Antisense; TCAACTTCAACATAAGCCCGCTTAG

Paste this into a BLAST search page for me
TGGATGAGCCGGAGAGCAACGCTAAGCCGCCATGTCCGTCGAAGAAAGGGACAGATGGGCGTGCTCTAAGTGTCCTAAGTGTCCGCAAACGTTTTGTAGTATTCACGTTTGTTGTGTGTGCCGTTGTGTGCCGTTTGCTCAACCCATTTAACCCCTCTTCAATGTGAACCTCTAAGTAATATACCAATCTGCTGCAGCCAATCTGCTGCAGCCAGGCACTCAAATGCACTCAAATTCCATTCATTCCAATCATTCCAATTTGTTTTACCACTGCATTTTACCACTGCAAGAGCCACAGCAGCCGCAACCCAATCAGCAGCAAAATTCAACTTCAACATAAGCCCGCTTAG

Full Affymetrix probeset data:

Annotations for 1628822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720