FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628823_at:

>probe:Drosophila_2:1628823_at:69:67; Interrogation_Position=3538; Antisense; ATGGATGCCTCACCATACTTCAACA
>probe:Drosophila_2:1628823_at:315:495; Interrogation_Position=3590; Antisense; GTCACCTTTCTGCAAAGACCGACTT
>probe:Drosophila_2:1628823_at:135:575; Interrogation_Position=3636; Antisense; GGCGAGCTTCTTCTTTGTGAATGCG
>probe:Drosophila_2:1628823_at:285:615; Interrogation_Position=3653; Antisense; TGAATGCGGCACCTCAGTGGCAGAC
>probe:Drosophila_2:1628823_at:668:151; Interrogation_Position=3745; Antisense; ACAGTGGATTGCTATACGGGCACAT
>probe:Drosophila_2:1628823_at:174:591; Interrogation_Position=3774; Antisense; TGTGTCCACCCTGCCGGATGTAAAT
>probe:Drosophila_2:1628823_at:236:529; Interrogation_Position=3809; Antisense; GGGAGCTCTATTTGGACTTTGATGA
>probe:Drosophila_2:1628823_at:720:159; Interrogation_Position=3839; Antisense; ACAATGGTCTGATTCCAGTGCCAAA
>probe:Drosophila_2:1628823_at:508:171; Interrogation_Position=3861; Antisense; AAAGTTGTACTTCCGCGTGATTATC
>probe:Drosophila_2:1628823_at:610:67; Interrogation_Position=3902; Antisense; ATGGCATCGTGCTACTTGGAGTTAA
>probe:Drosophila_2:1628823_at:335:437; Interrogation_Position=3958; Antisense; GAGGAGTACATCATCTGCCAGGATA
>probe:Drosophila_2:1628823_at:297:1; Interrogation_Position=4043; Antisense; ATGCCTGTACTGTGGAGGACTTTAC
>probe:Drosophila_2:1628823_at:680:411; Interrogation_Position=4081; Antisense; GACCTACCTTTACAAGACCTGTTTG
>probe:Drosophila_2:1628823_at:274:413; Interrogation_Position=4096; Antisense; GACCTGTTTGTCGATGGAGTCCTGG

Paste this into a BLAST search page for me
ATGGATGCCTCACCATACTTCAACAGTCACCTTTCTGCAAAGACCGACTTGGCGAGCTTCTTCTTTGTGAATGCGTGAATGCGGCACCTCAGTGGCAGACACAGTGGATTGCTATACGGGCACATTGTGTCCACCCTGCCGGATGTAAATGGGAGCTCTATTTGGACTTTGATGAACAATGGTCTGATTCCAGTGCCAAAAAAGTTGTACTTCCGCGTGATTATCATGGCATCGTGCTACTTGGAGTTAAGAGGAGTACATCATCTGCCAGGATAATGCCTGTACTGTGGAGGACTTTACGACCTACCTTTACAAGACCTGTTTGGACCTGTTTGTCGATGGAGTCCTGG

Full Affymetrix probeset data:

Annotations for 1628823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720