Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628825_at:

>probe:Drosophila_2:1628825_at:94:323; Interrogation_Position=1946; Antisense; GCGCCTCAAGAAACGTTAGTACTAT
>probe:Drosophila_2:1628825_at:27:91; Interrogation_Position=1963; Antisense; AGTACTATCGTACTTTTGTAGCAAG
>probe:Drosophila_2:1628825_at:620:485; Interrogation_Position=1980; Antisense; GTAGCAAGTTTTTATTTAGGCCGTG
>probe:Drosophila_2:1628825_at:139:579; Interrogation_Position=1998; Antisense; GGCCGTGAATAGAATAGTGCGTTAT
>probe:Drosophila_2:1628825_at:101:239; Interrogation_Position=2026; Antisense; AATCTGTTAAGTGCCTGCGTTTCTC
>probe:Drosophila_2:1628825_at:423:621; Interrogation_Position=2041; Antisense; TGCGTTTCTCACTCCAAACTGAAAT
>probe:Drosophila_2:1628825_at:411:285; Interrogation_Position=2059; Antisense; CTGAAATGTTTTCGTTTTGTTTGAT
>probe:Drosophila_2:1628825_at:131:709; Interrogation_Position=2093; Antisense; TTAATCGAACCCAACAGCTGAGCTC
>probe:Drosophila_2:1628825_at:32:121; Interrogation_Position=2108; Antisense; AGCTGAGCTCAGGTCCACTTATTGT
>probe:Drosophila_2:1628825_at:200:339; Interrogation_Position=2114; Antisense; GCTCAGGTCCACTTATTGTGTTATG
>probe:Drosophila_2:1628825_at:239:207; Interrogation_Position=2207; Antisense; AAGCATTACTTCCTGACATTTCTCG
>probe:Drosophila_2:1628825_at:722:149; Interrogation_Position=2214; Antisense; ACTTCCTGACATTTCTCGTGTCTAA
>probe:Drosophila_2:1628825_at:17:151; Interrogation_Position=2222; Antisense; ACATTTCTCGTGTCTAATTATTTTA
>probe:Drosophila_2:1628825_at:381:253; Interrogation_Position=2250; Antisense; CAACCCCATTAGAGAAACCATAAAT

Paste this into a BLAST search page for me
GCGCCTCAAGAAACGTTAGTACTATAGTACTATCGTACTTTTGTAGCAAGGTAGCAAGTTTTTATTTAGGCCGTGGGCCGTGAATAGAATAGTGCGTTATAATCTGTTAAGTGCCTGCGTTTCTCTGCGTTTCTCACTCCAAACTGAAATCTGAAATGTTTTCGTTTTGTTTGATTTAATCGAACCCAACAGCTGAGCTCAGCTGAGCTCAGGTCCACTTATTGTGCTCAGGTCCACTTATTGTGTTATGAAGCATTACTTCCTGACATTTCTCGACTTCCTGACATTTCTCGTGTCTAAACATTTCTCGTGTCTAATTATTTTACAACCCCATTAGAGAAACCATAAAT

Full Affymetrix probeset data:

Annotations for 1628825_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime