Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628828_s_at:

>probe:Drosophila_2:1628828_s_at:502:101; Interrogation_Position=1007; Antisense; AGAGATCTAGACGAAGGCTCCCCAC
>probe:Drosophila_2:1628828_s_at:293:441; Interrogation_Position=1063; Antisense; GATGGACGTCCATTCCAAGCTGATA
>probe:Drosophila_2:1628828_s_at:17:543; Interrogation_Position=1140; Antisense; GGATTCCATCGTTACCAGCATTATA
>probe:Drosophila_2:1628828_s_at:81:441; Interrogation_Position=650; Antisense; GATGGCCATATTGCCTTCAATGAGC
>probe:Drosophila_2:1628828_s_at:695:145; Interrogation_Position=710; Antisense; ACTCTGGCGCAGGATACACTTGAAG
>probe:Drosophila_2:1628828_s_at:416:205; Interrogation_Position=732; Antisense; AAGCGAATGCCCGTTTCTTTGACAA
>probe:Drosophila_2:1628828_s_at:207:267; Interrogation_Position=779; Antisense; CAGGCTTTAACCGTGGGCGTTGGCA
>probe:Drosophila_2:1628828_s_at:365:575; Interrogation_Position=794; Antisense; GGCGTTGGCACTGTGATGGACTCCA
>probe:Drosophila_2:1628828_s_at:274:29; Interrogation_Position=836; Antisense; ATCACCGGAGCTCACAAGGCATTTG
>probe:Drosophila_2:1628828_s_at:317:223; Interrogation_Position=851; Antisense; AAGGCATTTGCCCTGTACAAGGCCA
>probe:Drosophila_2:1628828_s_at:422:239; Interrogation_Position=890; Antisense; AATCACATGTGGACCGTCAGTGCCT
>probe:Drosophila_2:1628828_s_at:368:87; Interrogation_Position=908; Antisense; AGTGCCTTCCAGCAGCATGCAAATA
>probe:Drosophila_2:1628828_s_at:320:59; Interrogation_Position=938; Antisense; ATGATCTGCGACGAGGATGCCACTT
>probe:Drosophila_2:1628828_s_at:356:15; Interrogation_Position=990; Antisense; ATTTCAAGGGCATTCTCAGAGATCT

Paste this into a BLAST search page for me
AGAGATCTAGACGAAGGCTCCCCACGATGGACGTCCATTCCAAGCTGATAGGATTCCATCGTTACCAGCATTATAGATGGCCATATTGCCTTCAATGAGCACTCTGGCGCAGGATACACTTGAAGAAGCGAATGCCCGTTTCTTTGACAACAGGCTTTAACCGTGGGCGTTGGCAGGCGTTGGCACTGTGATGGACTCCAATCACCGGAGCTCACAAGGCATTTGAAGGCATTTGCCCTGTACAAGGCCAAATCACATGTGGACCGTCAGTGCCTAGTGCCTTCCAGCAGCATGCAAATAATGATCTGCGACGAGGATGCCACTTATTTCAAGGGCATTCTCAGAGATCT

Full Affymetrix probeset data:

Annotations for 1628828_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime