FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628829_at:

>probe:Drosophila_2:1628829_at:107:351; Interrogation_Position=1001; Antisense; GCAGCAGTACCATTTCGGGATCTTC
>probe:Drosophila_2:1628829_at:404:291; Interrogation_Position=1016; Antisense; CGGGATCTTCTACTCGTTCATTAAA
>probe:Drosophila_2:1628829_at:369:407; Interrogation_Position=1100; Antisense; GACGGACAGAATCAACGCCTTCATT
>probe:Drosophila_2:1628829_at:170:269; Interrogation_Position=1127; Antisense; CATACCCTTGGACTAGAAACGCTTT
>probe:Drosophila_2:1628829_at:58:341; Interrogation_Position=1147; Antisense; GCTTTTGCTTTCCTTCTTCGAAATG
>probe:Drosophila_2:1628829_at:614:395; Interrogation_Position=650; Antisense; GAAATTCTACGCCTATTGCAGCCAA
>probe:Drosophila_2:1628829_at:493:27; Interrogation_Position=685; Antisense; ATACCGCCAACGTGATGACCAATCT
>probe:Drosophila_2:1628829_at:455:127; Interrogation_Position=702; Antisense; ACCAATCTATTGTCCTTCGAGGCGG
>probe:Drosophila_2:1628829_at:612:437; Interrogation_Position=720; Antisense; GAGGCGGATCGTCGGACCATTACAA
>probe:Drosophila_2:1628829_at:691:549; Interrogation_Position=782; Antisense; GGAGCGTCTAAAGATGTTCCCCACC
>probe:Drosophila_2:1628829_at:693:577; Interrogation_Position=833; Antisense; GGCCTCCATGTCCACTTTAAATGAT
>probe:Drosophila_2:1628829_at:312:417; Interrogation_Position=921; Antisense; GAGCGCGACTCGGACGGCATGATTA
>probe:Drosophila_2:1628829_at:704:57; Interrogation_Position=939; Antisense; ATGATTACGCTGGAGGACCGCTTTC
>probe:Drosophila_2:1628829_at:144:413; Interrogation_Position=954; Antisense; GACCGCTTTCTCATGATGGAGGCCA

Paste this into a BLAST search page for me
GCAGCAGTACCATTTCGGGATCTTCCGGGATCTTCTACTCGTTCATTAAAGACGGACAGAATCAACGCCTTCATTCATACCCTTGGACTAGAAACGCTTTGCTTTTGCTTTCCTTCTTCGAAATGGAAATTCTACGCCTATTGCAGCCAAATACCGCCAACGTGATGACCAATCTACCAATCTATTGTCCTTCGAGGCGGGAGGCGGATCGTCGGACCATTACAAGGAGCGTCTAAAGATGTTCCCCACCGGCCTCCATGTCCACTTTAAATGATGAGCGCGACTCGGACGGCATGATTAATGATTACGCTGGAGGACCGCTTTCGACCGCTTTCTCATGATGGAGGCCA

Full Affymetrix probeset data:

Annotations for 1628829_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720