FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628830_at:

>probe:Drosophila_2:1628830_at:424:217; Interrogation_Position=104; Antisense; AATGTGGTCCGGAGGTCCACGACAA
>probe:Drosophila_2:1628830_at:578:129; Interrogation_Position=139; Antisense; ACCATATCCCAGATTGAGCGCGCAA
>probe:Drosophila_2:1628830_at:249:105; Interrogation_Position=198; Antisense; AGACGACGTGCATCCGATTCACTTC
>probe:Drosophila_2:1628830_at:467:131; Interrogation_Position=226; Antisense; ACCTGCATCATCTACGCCTTTGTAA
>probe:Drosophila_2:1628830_at:32:649; Interrogation_Position=287; Antisense; TCATGATCGATGATGGCACCGGCTC
>probe:Drosophila_2:1628830_at:252:181; Interrogation_Position=332; Antisense; AAAAACCCTTCAATGGACGCGTGAT
>probe:Drosophila_2:1628830_at:523:409; Interrogation_Position=347; Antisense; GACGCGTGATCAGCAGCCTGTACAG
>probe:Drosophila_2:1628830_at:730:315; Interrogation_Position=362; Antisense; GCCTGTACAGTGAAGCCAGTTCGCT
>probe:Drosophila_2:1628830_at:392:573; Interrogation_Position=431; Antisense; GGCTGCTGCAGGTCTCCATGGAGTA
>probe:Drosophila_2:1628830_at:627:503; Interrogation_Position=506; Antisense; GTCCGAATAGGTTCCGCGGCAAGAT
>probe:Drosophila_2:1628830_at:45:557; Interrogation_Position=537; Antisense; GGACGCTTTTCAGTTCTTCATAGAC
>probe:Drosophila_2:1628830_at:80:677; Interrogation_Position=557; Antisense; TAGACAGCGGCCGATCGCGGAATAT
>probe:Drosophila_2:1628830_at:130:559; Interrogation_Position=582; Antisense; GGAAATTGGCTTCGTAGACTACCTA
>probe:Drosophila_2:1628830_at:109:405; Interrogation_Position=598; Antisense; GACTACCTAACCGACTGGCAACGAA

Paste this into a BLAST search page for me
AATGTGGTCCGGAGGTCCACGACAAACCATATCCCAGATTGAGCGCGCAAAGACGACGTGCATCCGATTCACTTCACCTGCATCATCTACGCCTTTGTAATCATGATCGATGATGGCACCGGCTCAAAAACCCTTCAATGGACGCGTGATGACGCGTGATCAGCAGCCTGTACAGGCCTGTACAGTGAAGCCAGTTCGCTGGCTGCTGCAGGTCTCCATGGAGTAGTCCGAATAGGTTCCGCGGCAAGATGGACGCTTTTCAGTTCTTCATAGACTAGACAGCGGCCGATCGCGGAATATGGAAATTGGCTTCGTAGACTACCTAGACTACCTAACCGACTGGCAACGAA

Full Affymetrix probeset data:

Annotations for 1628830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720