FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628831_at:

>probe:Drosophila_2:1628831_at:693:175; Interrogation_Position=1009; Antisense; AAACTCCTCCATTAGTTACGATCGC
>probe:Drosophila_2:1628831_at:532:475; Interrogation_Position=1023; Antisense; GTTACGATCGCACGCACAGCTTGTT
>probe:Drosophila_2:1628831_at:246:19; Interrogation_Position=1052; Antisense; ATTTCGGGCTGCAAGACGCTGGAGA
>probe:Drosophila_2:1628831_at:596:521; Interrogation_Position=1082; Antisense; GTGGCCATGGCCATTTACTGAGAAA
>probe:Drosophila_2:1628831_at:559:295; Interrogation_Position=1111; Antisense; CGACCGACTCCACATTTTAATGCTT
>probe:Drosophila_2:1628831_at:349:165; Interrogation_Position=618; Antisense; AAATGCCCAGCGGAGTATTCGACCA
>probe:Drosophila_2:1628831_at:309:635; Interrogation_Position=650; Antisense; TCGCTGGTGGACTACAACGCCTTTG
>probe:Drosophila_2:1628831_at:109:201; Interrogation_Position=665; Antisense; AACGCCTTTGTCGATGGCACGGATA
>probe:Drosophila_2:1628831_at:5:227; Interrogation_Position=695; Antisense; AAGGCAATCTTCATCTTTCTCTCGA
>probe:Drosophila_2:1628831_at:497:485; Interrogation_Position=771; Antisense; GTAGGCTGCGCGAGGACACACGACT
>probe:Drosophila_2:1628831_at:558:401; Interrogation_Position=800; Antisense; GACTTTGAGCCCCTTTTGCGGAAGG
>probe:Drosophila_2:1628831_at:599:563; Interrogation_Position=819; Antisense; GGAAGGCCGCCTATAACATGGATGG
>probe:Drosophila_2:1628831_at:80:705; Interrogation_Position=879; Antisense; TTATCGATCATTTCATTCCGTTCCT
>probe:Drosophila_2:1628831_at:312:115; Interrogation_Position=945; Antisense; AGCTTTTAAGGTGGCGGCGCGATCC

Paste this into a BLAST search page for me
AAACTCCTCCATTAGTTACGATCGCGTTACGATCGCACGCACAGCTTGTTATTTCGGGCTGCAAGACGCTGGAGAGTGGCCATGGCCATTTACTGAGAAACGACCGACTCCACATTTTAATGCTTAAATGCCCAGCGGAGTATTCGACCATCGCTGGTGGACTACAACGCCTTTGAACGCCTTTGTCGATGGCACGGATAAAGGCAATCTTCATCTTTCTCTCGAGTAGGCTGCGCGAGGACACACGACTGACTTTGAGCCCCTTTTGCGGAAGGGGAAGGCCGCCTATAACATGGATGGTTATCGATCATTTCATTCCGTTCCTAGCTTTTAAGGTGGCGGCGCGATCC

Full Affymetrix probeset data:

Annotations for 1628831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720