Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628833_at:

>probe:Drosophila_2:1628833_at:344:293; Interrogation_Position=1739; Antisense; CGAGCTTCCCCTATATAGAGGCAGA
>probe:Drosophila_2:1628833_at:429:727; Interrogation_Position=1802; Antisense; TTGTGGACATCATCGCACGACGGTT
>probe:Drosophila_2:1628833_at:364:141; Interrogation_Position=1821; Antisense; ACGGTTGCGCATAGCCTTCGTGGAT
>probe:Drosophila_2:1628833_at:240:357; Interrogation_Position=1860; Antisense; GCACATGCTGCCTAGAATTCTCAAG
>probe:Drosophila_2:1628833_at:643:109; Interrogation_Position=1873; Antisense; AGAATTCTCAAGATCATGGCCGGCG
>probe:Drosophila_2:1628833_at:443:317; Interrogation_Position=1942; Antisense; GCCCAGGAGTTTCTGGTGCGCCAAA
>probe:Drosophila_2:1628833_at:393:545; Interrogation_Position=1975; Antisense; GGATCAATAGTCCAACCCAGGAGCA
>probe:Drosophila_2:1628833_at:638:373; Interrogation_Position=2100; Antisense; GAAGATTTGCGTTCAACCCTTGGTC
>probe:Drosophila_2:1628833_at:107:449; Interrogation_Position=2132; Antisense; GATCCATGTCTAGCATGTTCTTGCC
>probe:Drosophila_2:1628833_at:428:713; Interrogation_Position=2149; Antisense; TTCTTGCCCCTTATGACGAGCTTAA
>probe:Drosophila_2:1628833_at:696:647; Interrogation_Position=2171; Antisense; TAAGTTATGGACTCGGACGCTAATC
>probe:Drosophila_2:1628833_at:311:411; Interrogation_Position=2186; Antisense; GACGCTAATCGGTTGACATCGGACA
>probe:Drosophila_2:1628833_at:662:327; Interrogation_Position=2215; Antisense; GCGTTAACTAGCACTTGGCGCAACA
>probe:Drosophila_2:1628833_at:247:329; Interrogation_Position=2280; Antisense; GCGTGTGGGTCTTTCTATACCATTA

Paste this into a BLAST search page for me
CGAGCTTCCCCTATATAGAGGCAGATTGTGGACATCATCGCACGACGGTTACGGTTGCGCATAGCCTTCGTGGATGCACATGCTGCCTAGAATTCTCAAGAGAATTCTCAAGATCATGGCCGGCGGCCCAGGAGTTTCTGGTGCGCCAAAGGATCAATAGTCCAACCCAGGAGCAGAAGATTTGCGTTCAACCCTTGGTCGATCCATGTCTAGCATGTTCTTGCCTTCTTGCCCCTTATGACGAGCTTAATAAGTTATGGACTCGGACGCTAATCGACGCTAATCGGTTGACATCGGACAGCGTTAACTAGCACTTGGCGCAACAGCGTGTGGGTCTTTCTATACCATTA

Full Affymetrix probeset data:

Annotations for 1628833_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime