FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628835_at:

>probe:Drosophila_2:1628835_at:695:79; Interrogation_Position=1029; Antisense; AGGTCTTTAAGCGAACGATGCGTTA
>probe:Drosophila_2:1628835_at:162:383; Interrogation_Position=1041; Antisense; GAACGATGCGTTATACACTCACACA
>probe:Drosophila_2:1628835_at:686:145; Interrogation_Position=1079; Antisense; ACTCACTGCGAGCTAGCCTTAGTTA
>probe:Drosophila_2:1628835_at:409:427; Interrogation_Position=1110; Antisense; GAGATATCGATCCTGATACCGATTA
>probe:Drosophila_2:1628835_at:223:461; Interrogation_Position=1155; Antisense; GATTTTCATCACAAACGCATTTTCA
>probe:Drosophila_2:1628835_at:135:357; Interrogation_Position=1208; Antisense; GCACATTTCGCACACGATTTGTCAT
>probe:Drosophila_2:1628835_at:236:241; Interrogation_Position=763; Antisense; AATACCGATTTGCTTATCTCAACCC
>probe:Drosophila_2:1628835_at:660:641; Interrogation_Position=779; Antisense; TCTCAACCCAACTCATGGCAAACTG
>probe:Drosophila_2:1628835_at:662:697; Interrogation_Position=834; Antisense; TTTCAAGGACCTTAACGCGTGACAA
>probe:Drosophila_2:1628835_at:202:133; Interrogation_Position=848; Antisense; ACGCGTGACAAAGTTTACCAAGCAA
>probe:Drosophila_2:1628835_at:510:155; Interrogation_Position=896; Antisense; ACACCCAGCTCATAGGATTATTACT
>probe:Drosophila_2:1628835_at:671:685; Interrogation_Position=940; Antisense; TATCTCTGATGTTGTTTCTACCTGA
>probe:Drosophila_2:1628835_at:77:373; Interrogation_Position=972; Antisense; GAAGTATGTTTTCCATCTAGGCTGT
>probe:Drosophila_2:1628835_at:541:307; Interrogation_Position=984; Antisense; CCATCTAGGCTGTTTGTTTCAAATT

Paste this into a BLAST search page for me
AGGTCTTTAAGCGAACGATGCGTTAGAACGATGCGTTATACACTCACACAACTCACTGCGAGCTAGCCTTAGTTAGAGATATCGATCCTGATACCGATTAGATTTTCATCACAAACGCATTTTCAGCACATTTCGCACACGATTTGTCATAATACCGATTTGCTTATCTCAACCCTCTCAACCCAACTCATGGCAAACTGTTTCAAGGACCTTAACGCGTGACAAACGCGTGACAAAGTTTACCAAGCAAACACCCAGCTCATAGGATTATTACTTATCTCTGATGTTGTTTCTACCTGAGAAGTATGTTTTCCATCTAGGCTGTCCATCTAGGCTGTTTGTTTCAAATT

Full Affymetrix probeset data:

Annotations for 1628835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720