FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628838_at:

>probe:Drosophila_2:1628838_at:667:689; Interrogation_Position=1283; Antisense; TATTAGCAGGATGCCCATGTTCCAG
>probe:Drosophila_2:1628838_at:347:59; Interrogation_Position=1299; Antisense; ATGTTCCAGGCAAATCCCGGAGCAC
>probe:Drosophila_2:1628838_at:36:673; Interrogation_Position=1358; Antisense; TACGCGCGCCGTGGAATTCAGTGAA
>probe:Drosophila_2:1628838_at:19:245; Interrogation_Position=1372; Antisense; AATTCAGTGAATTTCCGCCGGAAGA
>probe:Drosophila_2:1628838_at:593:75; Interrogation_Position=1468; Antisense; AGGAGCGCAGGCGTTTTCTCTGCTA
>probe:Drosophila_2:1628838_at:240:207; Interrogation_Position=1518; Antisense; AAGCGTCCCCAGAATCATTTTCTAT
>probe:Drosophila_2:1628838_at:112:17; Interrogation_Position=1534; Antisense; ATTTTCTATTGCAACGCGCCGAATT
>probe:Drosophila_2:1628838_at:563:361; Interrogation_Position=1554; Antisense; GAATTTGTTTCCCAGGTGCTTTACT
>probe:Drosophila_2:1628838_at:193:699; Interrogation_Position=1573; Antisense; TTTACTCCGCCTTGTGCGATGAAGA
>probe:Drosophila_2:1628838_at:301:543; Interrogation_Position=1604; Antisense; GGATATTTCCTTTCCGATCTTGAGA
>probe:Drosophila_2:1628838_at:576:195; Interrogation_Position=1639; Antisense; AACTGAGGACCATTCCGGACAACGT
>probe:Drosophila_2:1628838_at:642:631; Interrogation_Position=1668; Antisense; TCCGGTGCCGGCGATGCTGAAAAGA
>probe:Drosophila_2:1628838_at:568:367; Interrogation_Position=1691; Antisense; GAATCCATCTAATCCGTAATCCATC
>probe:Drosophila_2:1628838_at:133:27; Interrogation_Position=1739; Antisense; ATAGCAGTTCTTATACCCTTTGTAT

Paste this into a BLAST search page for me
TATTAGCAGGATGCCCATGTTCCAGATGTTCCAGGCAAATCCCGGAGCACTACGCGCGCCGTGGAATTCAGTGAAAATTCAGTGAATTTCCGCCGGAAGAAGGAGCGCAGGCGTTTTCTCTGCTAAAGCGTCCCCAGAATCATTTTCTATATTTTCTATTGCAACGCGCCGAATTGAATTTGTTTCCCAGGTGCTTTACTTTTACTCCGCCTTGTGCGATGAAGAGGATATTTCCTTTCCGATCTTGAGAAACTGAGGACCATTCCGGACAACGTTCCGGTGCCGGCGATGCTGAAAAGAGAATCCATCTAATCCGTAATCCATCATAGCAGTTCTTATACCCTTTGTAT

Full Affymetrix probeset data:

Annotations for 1628838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720