FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628840_at:

>probe:Drosophila_2:1628840_at:471:717; Interrogation_Position=2491; Antisense; TTCGCCGGACGGACAATTGCAAAGA
>probe:Drosophila_2:1628840_at:84:479; Interrogation_Position=2595; Antisense; GTTTACGCAACGCAACACATTCACG
>probe:Drosophila_2:1628840_at:146:645; Interrogation_Position=2633; Antisense; TCATATTTCACGCAACGGCCTGGAG
>probe:Drosophila_2:1628840_at:334:119; Interrogation_Position=2656; Antisense; AGCTCCACATCTGAATCCGCATGAT
>probe:Drosophila_2:1628840_at:364:313; Interrogation_Position=2707; Antisense; GCCACTCACGTTGATTTCTCATTTA
>probe:Drosophila_2:1628840_at:428:91; Interrogation_Position=2732; Antisense; AGTTGTATTCGACATCCAATCCCTA
>probe:Drosophila_2:1628840_at:223:337; Interrogation_Position=2802; Antisense; GCTCTAGAAGCCCAATCCAATACTT
>probe:Drosophila_2:1628840_at:511:239; Interrogation_Position=2820; Antisense; AATACTTTTTAAGCGGCTGGTCCAT
>probe:Drosophila_2:1628840_at:398:573; Interrogation_Position=2834; Antisense; GGCTGGTCCATTCAGTGGAGCACTT
>probe:Drosophila_2:1628840_at:346:7; Interrogation_Position=2894; Antisense; ATTGCTATTGTATTTCCAACTCGTC
>probe:Drosophila_2:1628840_at:200:311; Interrogation_Position=2909; Antisense; CCAACTCGTCTAGCATGAACTTCAT
>probe:Drosophila_2:1628840_at:315:577; Interrogation_Position=2934; Antisense; GGCCCAAACTTGTACCTATATCTAC
>probe:Drosophila_2:1628840_at:167:689; Interrogation_Position=3002; Antisense; TATTCCCTCCTAAAATCGCCAATTA
>probe:Drosophila_2:1628840_at:708:599; Interrogation_Position=3039; Antisense; TGTACAGTATAATTCGCAAGCTCGT

Paste this into a BLAST search page for me
TTCGCCGGACGGACAATTGCAAAGAGTTTACGCAACGCAACACATTCACGTCATATTTCACGCAACGGCCTGGAGAGCTCCACATCTGAATCCGCATGATGCCACTCACGTTGATTTCTCATTTAAGTTGTATTCGACATCCAATCCCTAGCTCTAGAAGCCCAATCCAATACTTAATACTTTTTAAGCGGCTGGTCCATGGCTGGTCCATTCAGTGGAGCACTTATTGCTATTGTATTTCCAACTCGTCCCAACTCGTCTAGCATGAACTTCATGGCCCAAACTTGTACCTATATCTACTATTCCCTCCTAAAATCGCCAATTATGTACAGTATAATTCGCAAGCTCGT

Full Affymetrix probeset data:

Annotations for 1628840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720