Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628841_at:

>probe:Drosophila_2:1628841_at:86:219; Interrogation_Position=392; Antisense; AAGTACCAGACCTATCGGGTGCTGC
>probe:Drosophila_2:1628841_at:175:337; Interrogation_Position=412; Antisense; GCTGCCGGAGTATTCGCTAATTTGG
>probe:Drosophila_2:1628841_at:498:339; Interrogation_Position=427; Antisense; GCTAATTTGGCTAACCTTGATTTGG
>probe:Drosophila_2:1628841_at:469:461; Interrogation_Position=455; Antisense; GATTTTGGTGTAACCAGCTACCGCT
>probe:Drosophila_2:1628841_at:449:561; Interrogation_Position=482; Antisense; GGAACAACTCAATGTCGCTGCCCTT
>probe:Drosophila_2:1628841_at:82:279; Interrogation_Position=508; Antisense; CTCACGTTCCTCTCCGAAACATGGG
>probe:Drosophila_2:1628841_at:624:399; Interrogation_Position=547; Antisense; GACACCAGTTCTCTAATTGGCAAGA
>probe:Drosophila_2:1628841_at:386:181; Interrogation_Position=590; Antisense; AAAAATGGCTCTTCCAGTCGCCAAG
>probe:Drosophila_2:1628841_at:42:651; Interrogation_Position=618; Antisense; TCAGCCTCAATTTCTCTCGAGAATT
>probe:Drosophila_2:1628841_at:396:9; Interrogation_Position=640; Antisense; ATTGCCATTTATATACTGAGACCGG
>probe:Drosophila_2:1628841_at:367:283; Interrogation_Position=655; Antisense; CTGAGACCGGATACAAACGCATATA
>probe:Drosophila_2:1628841_at:19:479; Interrogation_Position=707; Antisense; GTTTATTTCCTAATACACCGCTGGA
>probe:Drosophila_2:1628841_at:100:667; Interrogation_Position=720; Antisense; TACACCGCTGGAAACATACTTTTTT
>probe:Drosophila_2:1628841_at:605:245; Interrogation_Position=806; Antisense; AATTATCCATATCCAAATCCGAGAG

Paste this into a BLAST search page for me
AAGTACCAGACCTATCGGGTGCTGCGCTGCCGGAGTATTCGCTAATTTGGGCTAATTTGGCTAACCTTGATTTGGGATTTTGGTGTAACCAGCTACCGCTGGAACAACTCAATGTCGCTGCCCTTCTCACGTTCCTCTCCGAAACATGGGGACACCAGTTCTCTAATTGGCAAGAAAAAATGGCTCTTCCAGTCGCCAAGTCAGCCTCAATTTCTCTCGAGAATTATTGCCATTTATATACTGAGACCGGCTGAGACCGGATACAAACGCATATAGTTTATTTCCTAATACACCGCTGGATACACCGCTGGAAACATACTTTTTTAATTATCCATATCCAAATCCGAGAG

Full Affymetrix probeset data:

Annotations for 1628841_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime