FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628846_at:

>probe:Drosophila_2:1628846_at:133:671; Interrogation_Position=1024; Antisense; TACGTGTGCAAGTACTGCGGCAAGC
>probe:Drosophila_2:1628846_at:520:459; Interrogation_Position=1049; Antisense; GATTTGACAACTGCCTCAAGCGGCT
>probe:Drosophila_2:1628846_at:111:653; Interrogation_Position=1064; Antisense; TCAAGCGGCTGAACCACGAGCGCAA
>probe:Drosophila_2:1628846_at:8:517; Interrogation_Position=1120; Antisense; GTGTGCTCCACATGCCAGAAGGCCT
>probe:Drosophila_2:1628846_at:332:651; Interrogation_Position=1145; Antisense; TCAAGACTTCGACGGCTCTCAAGGA
>probe:Drosophila_2:1628846_at:697:117; Interrogation_Position=1211; Antisense; AGCTCTGCCAAACGTTCTTCAATAG
>probe:Drosophila_2:1628846_at:318:219; Interrogation_Position=1261; Antisense; AAGTCGAAGCACCATCGCCTGAAAG
>probe:Drosophila_2:1628846_at:380:229; Interrogation_Position=1311; Antisense; AATGGATGCTACTGTCCAAGCGGAT
>probe:Drosophila_2:1628846_at:473:439; Interrogation_Position=1333; Antisense; GATGGGTAAATCGTTGGTTCCTTGA
>probe:Drosophila_2:1628846_at:154:101; Interrogation_Position=1357; Antisense; AGAGGATTATTTCGCATGTTCTGCT
>probe:Drosophila_2:1628846_at:316:7; Interrogation_Position=1382; Antisense; ATTGACATGCAAAATGCCCCTCTGG
>probe:Drosophila_2:1628846_at:346:49; Interrogation_Position=1395; Antisense; ATGCCCCTCTGGAAACTTTCTAAAG
>probe:Drosophila_2:1628846_at:649:3; Interrogation_Position=1435; Antisense; ATTGGTTACAAATTGCTCCCTCATC
>probe:Drosophila_2:1628846_at:268:275; Interrogation_Position=1498; Antisense; CTATCTTCCCTTGTTTCCTAATAAG

Paste this into a BLAST search page for me
TACGTGTGCAAGTACTGCGGCAAGCGATTTGACAACTGCCTCAAGCGGCTTCAAGCGGCTGAACCACGAGCGCAAGTGTGCTCCACATGCCAGAAGGCCTTCAAGACTTCGACGGCTCTCAAGGAAGCTCTGCCAAACGTTCTTCAATAGAAGTCGAAGCACCATCGCCTGAAAGAATGGATGCTACTGTCCAAGCGGATGATGGGTAAATCGTTGGTTCCTTGAAGAGGATTATTTCGCATGTTCTGCTATTGACATGCAAAATGCCCCTCTGGATGCCCCTCTGGAAACTTTCTAAAGATTGGTTACAAATTGCTCCCTCATCCTATCTTCCCTTGTTTCCTAATAAG

Full Affymetrix probeset data:

Annotations for 1628846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720