FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628848_at:

>probe:Drosophila_2:1628848_at:40:425; Interrogation_Position=1381; Antisense; GAGACGGTCTGCGAGATGTGTTCCA
>probe:Drosophila_2:1628848_at:551:63; Interrogation_Position=1396; Antisense; ATGTGTTCCATAGATGCCAGTCCGC
>probe:Drosophila_2:1628848_at:595:257; Interrogation_Position=1441; Antisense; CACACCCACGTCAATCTGGTTAATG
>probe:Drosophila_2:1628848_at:537:611; Interrogation_Position=1478; Antisense; TGAAGCTGCTCGAGACAAGGGTCCA
>probe:Drosophila_2:1628848_at:682:503; Interrogation_Position=1498; Antisense; GTCCAGGAGCTGACGGCTAGTGTTT
>probe:Drosophila_2:1628848_at:17:625; Interrogation_Position=1592; Antisense; TGCCCACCGATCTCAATGACATTGT
>probe:Drosophila_2:1628848_at:599:85; Interrogation_Position=1637; Antisense; AGTGCGCCGAGGGTGAAGCCTTCAA
>probe:Drosophila_2:1628848_at:69:575; Interrogation_Position=1672; Antisense; GGCGGCGATGGTGTCCTTGTCCACA
>probe:Drosophila_2:1628848_at:375:475; Interrogation_Position=1732; Antisense; GTTACGCAGCCGGAGATGCAGTACC
>probe:Drosophila_2:1628848_at:674:615; Interrogation_Position=1760; Antisense; TGCACAGCATCAGCCAGTGTCGTCT
>probe:Drosophila_2:1628848_at:472:577; Interrogation_Position=1803; Antisense; GGCCGCCAAGCGCAACATGTAGTTC
>probe:Drosophila_2:1628848_at:592:239; Interrogation_Position=1844; Antisense; AATCACATTCCCATTAGTTTCGGTT
>probe:Drosophila_2:1628848_at:368:25; Interrogation_Position=1879; Antisense; ATATGTGCAACATTTTCCGGTTAGA
>probe:Drosophila_2:1628848_at:613:499; Interrogation_Position=1921; Antisense; GTCTGATTCTCATGTTTCGGTTGCA

Paste this into a BLAST search page for me
GAGACGGTCTGCGAGATGTGTTCCAATGTGTTCCATAGATGCCAGTCCGCCACACCCACGTCAATCTGGTTAATGTGAAGCTGCTCGAGACAAGGGTCCAGTCCAGGAGCTGACGGCTAGTGTTTTGCCCACCGATCTCAATGACATTGTAGTGCGCCGAGGGTGAAGCCTTCAAGGCGGCGATGGTGTCCTTGTCCACAGTTACGCAGCCGGAGATGCAGTACCTGCACAGCATCAGCCAGTGTCGTCTGGCCGCCAAGCGCAACATGTAGTTCAATCACATTCCCATTAGTTTCGGTTATATGTGCAACATTTTCCGGTTAGAGTCTGATTCTCATGTTTCGGTTGCA

Full Affymetrix probeset data:

Annotations for 1628848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720