Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628850_at:

>probe:Drosophila_2:1628850_at:730:125; Interrogation_Position=299; Antisense; AGCCAACAGCCTATTGTGATCAATA
>probe:Drosophila_2:1628850_at:682:513; Interrogation_Position=314; Antisense; GTGATCAATACAGTCCATTTACCAT
>probe:Drosophila_2:1628850_at:596:65; Interrogation_Position=337; Antisense; ATGGACTGCGAAGGATTCCCCAATC
>probe:Drosophila_2:1628850_at:174:117; Interrogation_Position=409; Antisense; AGCTTCTACATGTCGAACTTCGGCG
>probe:Drosophila_2:1628850_at:170:169; Interrogation_Position=442; Antisense; AAAGGCGGCCAGATCAGATTCACCT
>probe:Drosophila_2:1628850_at:257:103; Interrogation_Position=473; Antisense; AGACCAAAAATCTCGAGGCTCGCTT
>probe:Drosophila_2:1628850_at:462:117; Interrogation_Position=502; Antisense; AGCTCCAAGTACCTGTCGCCGGAGG
>probe:Drosophila_2:1628850_at:724:651; Interrogation_Position=551; Antisense; TCAAGCTGACCGACCGCCAGGTGAA
>probe:Drosophila_2:1628850_at:34:181; Interrogation_Position=574; Antisense; AAGACCTGGTTTCAGAACCGGCGCG
>probe:Drosophila_2:1628850_at:6:411; Interrogation_Position=608; Antisense; GACGAGCCAATCTCAGCAAGCGCAG
>probe:Drosophila_2:1628850_at:70:27; Interrogation_Position=652; Antisense; ATAGCAGGCGCTGCCGTGGGATCAC
>probe:Drosophila_2:1628850_at:424:637; Interrogation_Position=688; Antisense; TCGAGCAGCAGTGTTCCCGTGTTGA
>probe:Drosophila_2:1628850_at:566:469; Interrogation_Position=700; Antisense; GTTCCCGTGTTGAATCTTGGCAGCG
>probe:Drosophila_2:1628850_at:455:263; Interrogation_Position=720; Antisense; CAGCGGAAGCAGGTGTGGCCAACAA

Paste this into a BLAST search page for me
AGCCAACAGCCTATTGTGATCAATAGTGATCAATACAGTCCATTTACCATATGGACTGCGAAGGATTCCCCAATCAGCTTCTACATGTCGAACTTCGGCGAAAGGCGGCCAGATCAGATTCACCTAGACCAAAAATCTCGAGGCTCGCTTAGCTCCAAGTACCTGTCGCCGGAGGTCAAGCTGACCGACCGCCAGGTGAAAAGACCTGGTTTCAGAACCGGCGCGGACGAGCCAATCTCAGCAAGCGCAGATAGCAGGCGCTGCCGTGGGATCACTCGAGCAGCAGTGTTCCCGTGTTGAGTTCCCGTGTTGAATCTTGGCAGCGCAGCGGAAGCAGGTGTGGCCAACAA

Full Affymetrix probeset data:

Annotations for 1628850_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime