Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628852_at:

>probe:Drosophila_2:1628852_at:48:123; Interrogation_Position=481; Antisense; AGCGTGGAGATCTTCCTGGAGTTCA
>probe:Drosophila_2:1628852_at:697:587; Interrogation_Position=497; Antisense; TGGAGTTCATATACACCTTCGAGGT
>probe:Drosophila_2:1628852_at:1:531; Interrogation_Position=554; Antisense; GGGATATGTTCATCCTGTCCTGCGC
>probe:Drosophila_2:1628852_at:236:307; Interrogation_Position=597; Antisense; CCTTCGCTCCTTTGCTGAGAAACTA
>probe:Drosophila_2:1628852_at:314:363; Interrogation_Position=631; Antisense; GAATTGCCTCTGGATGGCATCTTTC
>probe:Drosophila_2:1628852_at:91:637; Interrogation_Position=662; Antisense; TCGACCTAGCATTCCGGCATAACAT
>probe:Drosophila_2:1628852_at:680:595; Interrogation_Position=693; Antisense; TGTGGAGCGCGTTTGCATCGAGAAA
>probe:Drosophila_2:1628852_at:470:645; Interrogation_Position=736; Antisense; TCATTGATCCACGAACCCAGTTTAA
>probe:Drosophila_2:1628852_at:251:613; Interrogation_Position=761; Antisense; TGAAACTCCCGGTCTATGCTCTAAA
>probe:Drosophila_2:1628852_at:557:605; Interrogation_Position=870; Antisense; TGAGATTACATTCGCCAACACGCAA
>probe:Drosophila_2:1628852_at:195:245; Interrogation_Position=896; Antisense; AATTCCCGCACTTCACCAAAATTAT
>probe:Drosophila_2:1628852_at:616:91; Interrogation_Position=923; Antisense; AGTATTTCCCCAATGTTCTTCTGGA
>probe:Drosophila_2:1628852_at:294:715; Interrogation_Position=941; Antisense; TTCTGGACGCCGAGGGATTCATCAA
>probe:Drosophila_2:1628852_at:95:585; Interrogation_Position=985; Antisense; TGGAATTCCCAAAAGCTTCGCGCAT

Paste this into a BLAST search page for me
AGCGTGGAGATCTTCCTGGAGTTCATGGAGTTCATATACACCTTCGAGGTGGGATATGTTCATCCTGTCCTGCGCCCTTCGCTCCTTTGCTGAGAAACTAGAATTGCCTCTGGATGGCATCTTTCTCGACCTAGCATTCCGGCATAACATTGTGGAGCGCGTTTGCATCGAGAAATCATTGATCCACGAACCCAGTTTAATGAAACTCCCGGTCTATGCTCTAAATGAGATTACATTCGCCAACACGCAAAATTCCCGCACTTCACCAAAATTATAGTATTTCCCCAATGTTCTTCTGGATTCTGGACGCCGAGGGATTCATCAATGGAATTCCCAAAAGCTTCGCGCAT

Full Affymetrix probeset data:

Annotations for 1628852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime