FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628853_at:

>probe:Drosophila_2:1628853_at:417:175; Interrogation_Position=2987; Antisense; AAAGCCTTCTGGACAGAGACAACTG
>probe:Drosophila_2:1628853_at:725:395; Interrogation_Position=3004; Antisense; GACAACTGTGATAACGACTTCTGAA
>probe:Drosophila_2:1628853_at:363:135; Interrogation_Position=3017; Antisense; ACGACTTCTGAATTCTACGCTTAAA
>probe:Drosophila_2:1628853_at:166:195; Interrogation_Position=3068; Antisense; AACTGCTCACAGTATTTGCGACCCG
>probe:Drosophila_2:1628853_at:393:19; Interrogation_Position=3081; Antisense; ATTTGCGACCCGTATAGACCTATAG
>probe:Drosophila_2:1628853_at:584:417; Interrogation_Position=3113; Antisense; GAGCTAGAGCTAATTTCACACAAAG
>probe:Drosophila_2:1628853_at:105:665; Interrogation_Position=3184; Antisense; TAAATCCACTGCACTTCTTACATAT
>probe:Drosophila_2:1628853_at:590:77; Interrogation_Position=3222; Antisense; AGGTAGCACACACGATATCTTAACT
>probe:Drosophila_2:1628853_at:91:359; Interrogation_Position=3278; Antisense; GCAAAAGCCGCTTTCTTTAGCTGTT
>probe:Drosophila_2:1628853_at:422:39; Interrogation_Position=3346; Antisense; ATCTCTGCGCATTATTCCCTGAAAT
>probe:Drosophila_2:1628853_at:627:525; Interrogation_Position=3376; Antisense; GGGCAAGAACTTATGGTCCCTGCTT
>probe:Drosophila_2:1628853_at:172:705; Interrogation_Position=3386; Antisense; TTATGGTCCCTGCTTTGATTTCCAT
>probe:Drosophila_2:1628853_at:461:679; Interrogation_Position=3458; Antisense; TAGTCGCTATATACTCAGCCAACGG
>probe:Drosophila_2:1628853_at:424:89; Interrogation_Position=3530; Antisense; AGTTTTTGGCGTCTTGTATCTTCAA

Paste this into a BLAST search page for me
AAAGCCTTCTGGACAGAGACAACTGGACAACTGTGATAACGACTTCTGAAACGACTTCTGAATTCTACGCTTAAAAACTGCTCACAGTATTTGCGACCCGATTTGCGACCCGTATAGACCTATAGGAGCTAGAGCTAATTTCACACAAAGTAAATCCACTGCACTTCTTACATATAGGTAGCACACACGATATCTTAACTGCAAAAGCCGCTTTCTTTAGCTGTTATCTCTGCGCATTATTCCCTGAAATGGGCAAGAACTTATGGTCCCTGCTTTTATGGTCCCTGCTTTGATTTCCATTAGTCGCTATATACTCAGCCAACGGAGTTTTTGGCGTCTTGTATCTTCAA

Full Affymetrix probeset data:

Annotations for 1628853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720