FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628854_at:

>probe:Drosophila_2:1628854_at:707:193; Interrogation_Position=417; Antisense; AACGTATTTGGAGCCCAGACTGCAG
>probe:Drosophila_2:1628854_at:366:467; Interrogation_Position=444; Antisense; GTTGATGCTGTACACGTGCACCGAG
>probe:Drosophila_2:1628854_at:423:327; Interrogation_Position=470; Antisense; GCGAGGTGTCATCCAGAGCACTGAA
>probe:Drosophila_2:1628854_at:333:51; Interrogation_Position=646; Antisense; ATGCTATTAGACGAGGTCCGGCCCA
>probe:Drosophila_2:1628854_at:156:537; Interrogation_Position=675; Antisense; GGTCTGCTGATAACCTGACATCGCA
>probe:Drosophila_2:1628854_at:585:267; Interrogation_Position=729; Antisense; CATACTACAAGTCCGAGCAATGCGT
>probe:Drosophila_2:1628854_at:129:329; Interrogation_Position=750; Antisense; GCGTAGTTGCTCTTATCTACACAAG
>probe:Drosophila_2:1628854_at:717:483; Interrogation_Position=774; Antisense; GTATCCGTGTTATGTGGCGGCACTT
>probe:Drosophila_2:1628854_at:668:581; Interrogation_Position=788; Antisense; TGGCGGCACTTGTATCTCTGCATCT
>probe:Drosophila_2:1628854_at:550:483; Interrogation_Position=819; Antisense; GTATCTGTATGCCAATGCCACCCAG
>probe:Drosophila_2:1628854_at:211:611; Interrogation_Position=895; Antisense; TGAACTTCCTAAAGTGACCCGGCCA
>probe:Drosophila_2:1628854_at:605:579; Interrogation_Position=915; Antisense; GGCCACGCGCACAGAAATAACTAGT
>probe:Drosophila_2:1628854_at:205:277; Interrogation_Position=935; Antisense; CTAGTATAAACCGTGCCCAGTTGGT
>probe:Drosophila_2:1628854_at:696:537; Interrogation_Position=957; Antisense; GGTTTTGGCCAATCTTGTACGAGTA

Paste this into a BLAST search page for me
AACGTATTTGGAGCCCAGACTGCAGGTTGATGCTGTACACGTGCACCGAGGCGAGGTGTCATCCAGAGCACTGAAATGCTATTAGACGAGGTCCGGCCCAGGTCTGCTGATAACCTGACATCGCACATACTACAAGTCCGAGCAATGCGTGCGTAGTTGCTCTTATCTACACAAGGTATCCGTGTTATGTGGCGGCACTTTGGCGGCACTTGTATCTCTGCATCTGTATCTGTATGCCAATGCCACCCAGTGAACTTCCTAAAGTGACCCGGCCAGGCCACGCGCACAGAAATAACTAGTCTAGTATAAACCGTGCCCAGTTGGTGGTTTTGGCCAATCTTGTACGAGTA

Full Affymetrix probeset data:

Annotations for 1628854_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720