Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628859_at:

>probe:Drosophila_2:1628859_at:73:443; Interrogation_Position=2821; Antisense; GATCCTTAAATCCTAGAAATCCAGA
>probe:Drosophila_2:1628859_at:73:235; Interrogation_Position=2877; Antisense; AATCGCTTGCGTATTATTGTAGTCA
>probe:Drosophila_2:1628859_at:726:501; Interrogation_Position=2964; Antisense; GTCGAGATGCACATGATTTCTTTAA
>probe:Drosophila_2:1628859_at:501:475; Interrogation_Position=3000; Antisense; GTTTTTCGTAATGTCTACTTCCCTG
>probe:Drosophila_2:1628859_at:370:493; Interrogation_Position=3007; Antisense; GTAATGTCTACTTCCCTGTGTAGAT
>probe:Drosophila_2:1628859_at:550:167; Interrogation_Position=3057; Antisense; AAATGTCTGTGCATTTGTTCGTGCA
>probe:Drosophila_2:1628859_at:325:273; Interrogation_Position=3068; Antisense; CATTTGTTCGTGCATGCCTAATTAA
>probe:Drosophila_2:1628859_at:212:655; Interrogation_Position=3111; Antisense; TAATTGATTACTTGATGTACACCCC
>probe:Drosophila_2:1628859_at:290:661; Interrogation_Position=3144; Antisense; TAACTCTCCACACATTATCAACGGC
>probe:Drosophila_2:1628859_at:384:683; Interrogation_Position=3158; Antisense; TTATCAACGGCATACGCTCAAAAGT
>probe:Drosophila_2:1628859_at:159:193; Interrogation_Position=3189; Antisense; AACTATTTGTATGGGCAGATGCTTA
>probe:Drosophila_2:1628859_at:353:443; Interrogation_Position=3206; Antisense; GATGCTTAGTGACGATATTAACCAA
>probe:Drosophila_2:1628859_at:317:241; Interrogation_Position=3261; Antisense; AATAGCTTTCGTTAACTGCATTGTG
>probe:Drosophila_2:1628859_at:181:195; Interrogation_Position=3274; Antisense; AACTGCATTGTGTTGTTGTTGATGT

Paste this into a BLAST search page for me
GATCCTTAAATCCTAGAAATCCAGAAATCGCTTGCGTATTATTGTAGTCAGTCGAGATGCACATGATTTCTTTAAGTTTTTCGTAATGTCTACTTCCCTGGTAATGTCTACTTCCCTGTGTAGATAAATGTCTGTGCATTTGTTCGTGCACATTTGTTCGTGCATGCCTAATTAATAATTGATTACTTGATGTACACCCCTAACTCTCCACACATTATCAACGGCTTATCAACGGCATACGCTCAAAAGTAACTATTTGTATGGGCAGATGCTTAGATGCTTAGTGACGATATTAACCAAAATAGCTTTCGTTAACTGCATTGTGAACTGCATTGTGTTGTTGTTGATGT

Full Affymetrix probeset data:

Annotations for 1628859_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime