FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628861_at:

>probe:Drosophila_2:1628861_at:394:623; Interrogation_Position=1667; Antisense; TGCGTAGCCTCCAGCTGAACAGGAA
>probe:Drosophila_2:1628861_at:547:673; Interrogation_Position=1745; Antisense; TATCCGGGCGCGCTGAAATGGAATC
>probe:Drosophila_2:1628861_at:153:63; Interrogation_Position=1762; Antisense; ATGGAATCGTTAGGTCCGGCACCCG
>probe:Drosophila_2:1628861_at:43:465; Interrogation_Position=1786; Antisense; GATTGCCCGCAATGCCAGAGTTTAC
>probe:Drosophila_2:1628861_at:100:455; Interrogation_Position=1858; Antisense; GATCACTGGTGCACCTGTTGGGAAT
>probe:Drosophila_2:1628861_at:490:295; Interrogation_Position=1895; Antisense; CGAGCACCTCGAAGGAGTCGCGGAT
>probe:Drosophila_2:1628861_at:433:329; Interrogation_Position=1929; Antisense; GCGTGTGGTCAGCTATCTCAATAAC
>probe:Drosophila_2:1628861_at:291:193; Interrogation_Position=1951; Antisense; AACTATGTGGCCGAGTTCCGAAACG
>probe:Drosophila_2:1628861_at:249:177; Interrogation_Position=1971; Antisense; AAACGGCACCTTTGCCAAGCTATGT
>probe:Drosophila_2:1628861_at:29:637; Interrogation_Position=2051; Antisense; TCGATCCGGATGAGGTGCACACCTA
>probe:Drosophila_2:1628861_at:126:617; Interrogation_Position=2066; Antisense; TGCACACCTATCGACTGATCTTTGT
>probe:Drosophila_2:1628861_at:363:605; Interrogation_Position=2081; Antisense; TGATCTTTGTCACGTCGCCCAATAA
>probe:Drosophila_2:1628861_at:228:489; Interrogation_Position=2112; Antisense; GTACGAAGCCACGTTGCGACACAAT
>probe:Drosophila_2:1628861_at:29:641; Interrogation_Position=2167; Antisense; TCGGTGAGCCGATTGAATGTCTACA

Paste this into a BLAST search page for me
TGCGTAGCCTCCAGCTGAACAGGAATATCCGGGCGCGCTGAAATGGAATCATGGAATCGTTAGGTCCGGCACCCGGATTGCCCGCAATGCCAGAGTTTACGATCACTGGTGCACCTGTTGGGAATCGAGCACCTCGAAGGAGTCGCGGATGCGTGTGGTCAGCTATCTCAATAACAACTATGTGGCCGAGTTCCGAAACGAAACGGCACCTTTGCCAAGCTATGTTCGATCCGGATGAGGTGCACACCTATGCACACCTATCGACTGATCTTTGTTGATCTTTGTCACGTCGCCCAATAAGTACGAAGCCACGTTGCGACACAATTCGGTGAGCCGATTGAATGTCTACA

Full Affymetrix probeset data:

Annotations for 1628861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720