FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628862_at:

>probe:Drosophila_2:1628862_at:412:523; Interrogation_Position=4914; Antisense; GGGCACGGGAATGCTCCGTACAGCA
>probe:Drosophila_2:1628862_at:206:119; Interrogation_Position=4938; Antisense; AGCTCGCTGCAACATCATCGACTAA
>probe:Drosophila_2:1628862_at:166:411; Interrogation_Position=4963; Antisense; GACGCTGTTCGTCGTACAATGCGGA
>probe:Drosophila_2:1628862_at:64:423; Interrogation_Position=4986; Antisense; GAGAATGCCTACGAGCACTTTGCGG
>probe:Drosophila_2:1628862_at:317:361; Interrogation_Position=5026; Antisense; GCAAGACGCGCGACCACATGAATAA
>probe:Drosophila_2:1628862_at:277:95; Interrogation_Position=5062; Antisense; AGTTGTGACGGTGGTACGACATGCT
>probe:Drosophila_2:1628862_at:302:401; Interrogation_Position=5079; Antisense; GACATGCTGGTGGTTATTGATCTCT
>probe:Drosophila_2:1628862_at:42:691; Interrogation_Position=5093; Antisense; TATTGATCTCTATGTCTCCGTTGGC
>probe:Drosophila_2:1628862_at:195:579; Interrogation_Position=5114; Antisense; TGGCCTCCCGTCTATTTTATTACAA
>probe:Drosophila_2:1628862_at:47:277; Interrogation_Position=5146; Antisense; CTATAGATGTCGTGTCCTGTGTGTC
>probe:Drosophila_2:1628862_at:216:21; Interrogation_Position=5206; Antisense; ATATATCACGTAAGGGCGAGCTAGC
>probe:Drosophila_2:1628862_at:705:425; Interrogation_Position=5231; Antisense; GAGATGGATTCGTTCGGTTTGGATC
>probe:Drosophila_2:1628862_at:591:435; Interrogation_Position=5349; Antisense; GAGGTTACAAGTTCTTTGCCGATGA
>probe:Drosophila_2:1628862_at:329:135; Interrogation_Position=5396; Antisense; ACGCTCGCGCGTTTATTTAAGTGTT

Paste this into a BLAST search page for me
GGGCACGGGAATGCTCCGTACAGCAAGCTCGCTGCAACATCATCGACTAAGACGCTGTTCGTCGTACAATGCGGAGAGAATGCCTACGAGCACTTTGCGGGCAAGACGCGCGACCACATGAATAAAGTTGTGACGGTGGTACGACATGCTGACATGCTGGTGGTTATTGATCTCTTATTGATCTCTATGTCTCCGTTGGCTGGCCTCCCGTCTATTTTATTACAACTATAGATGTCGTGTCCTGTGTGTCATATATCACGTAAGGGCGAGCTAGCGAGATGGATTCGTTCGGTTTGGATCGAGGTTACAAGTTCTTTGCCGATGAACGCTCGCGCGTTTATTTAAGTGTT

Full Affymetrix probeset data:

Annotations for 1628862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720