FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628864_at:

>probe:Drosophila_2:1628864_at:286:3; Interrogation_Position=1011; Antisense; ATTGGCTATCAATGCTGAGGGCTTT
>probe:Drosophila_2:1628864_at:690:341; Interrogation_Position=1053; Antisense; GCTTCTAATGTCGATTTTGGCTGCG
>probe:Drosophila_2:1628864_at:262:495; Interrogation_Position=533; Antisense; GTCACCACGTGAGTCTGTTAGGCAT
>probe:Drosophila_2:1628864_at:542:433; Interrogation_Position=577; Antisense; GAGTGTCATCTGATGGGCGCCAACT
>probe:Drosophila_2:1628864_at:364:553; Interrogation_Position=609; Antisense; GGACGGCAATGCCAATCGGCTTTGC
>probe:Drosophila_2:1628864_at:555:337; Interrogation_Position=632; Antisense; GCTCCCTAGAGTTTCTGTTAGCACT
>probe:Drosophila_2:1628864_at:722:617; Interrogation_Position=677; Antisense; TGCATTATCTGTTTACCCACTTCAA
>probe:Drosophila_2:1628864_at:461:147; Interrogation_Position=695; Antisense; ACTTCAACGATCTTTTCGGCTGGTC
>probe:Drosophila_2:1628864_at:204:591; Interrogation_Position=715; Antisense; TGGTCCATACTTGGCACCTACGTGG
>probe:Drosophila_2:1628864_at:206:261; Interrogation_Position=729; Antisense; CACCTACGTGGTTCTGTTTTCAGAT
>probe:Drosophila_2:1628864_at:549:339; Interrogation_Position=832; Antisense; GTTTTTGTACCCTCATTCTTCAACA
>probe:Drosophila_2:1628864_at:564:37; Interrogation_Position=856; Antisense; ATCTTAGTGTTTTGCCGTTGTGGAG
>probe:Drosophila_2:1628864_at:590:429; Interrogation_Position=880; Antisense; GAGTTTTGCCAACGACAGAGTGTCT
>probe:Drosophila_2:1628864_at:347:283; Interrogation_Position=933; Antisense; CTGCCATCCCTCGATTGGAAGAGAA

Paste this into a BLAST search page for me
ATTGGCTATCAATGCTGAGGGCTTTGCTTCTAATGTCGATTTTGGCTGCGGTCACCACGTGAGTCTGTTAGGCATGAGTGTCATCTGATGGGCGCCAACTGGACGGCAATGCCAATCGGCTTTGCGCTCCCTAGAGTTTCTGTTAGCACTTGCATTATCTGTTTACCCACTTCAAACTTCAACGATCTTTTCGGCTGGTCTGGTCCATACTTGGCACCTACGTGGCACCTACGTGGTTCTGTTTTCAGATGTTTTTGTACCCTCATTCTTCAACAATCTTAGTGTTTTGCCGTTGTGGAGGAGTTTTGCCAACGACAGAGTGTCTCTGCCATCCCTCGATTGGAAGAGAA

Full Affymetrix probeset data:

Annotations for 1628864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720