FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628865_at:

>probe:Drosophila_2:1628865_at:213:381; Interrogation_Position=2353; Antisense; GAACGAAAGTCGGAAGCTCTTATTT
>probe:Drosophila_2:1628865_at:228:339; Interrogation_Position=2368; Antisense; GCTCTTATTTTGATTCGTCTTTGAA
>probe:Drosophila_2:1628865_at:171:185; Interrogation_Position=2490; Antisense; AACGTAGTTCTCTAGTTGCAAAACA
>probe:Drosophila_2:1628865_at:454:709; Interrogation_Position=2631; Antisense; TTAAGCATATTGACTACCTAGCCGT
>probe:Drosophila_2:1628865_at:555:401; Interrogation_Position=2642; Antisense; GACTACCTAGCCGTTAAGACTTAGC
>probe:Drosophila_2:1628865_at:319:245; Interrogation_Position=2668; Antisense; AATTTTTTGTCGGAGCAGCTTTCAT
>probe:Drosophila_2:1628865_at:483:551; Interrogation_Position=2679; Antisense; GGAGCAGCTTTCATTCTCGTCATCC
>probe:Drosophila_2:1628865_at:651:45; Interrogation_Position=2710; Antisense; ATCCGCCAGCTTTCTAGTACAAAAA
>probe:Drosophila_2:1628865_at:228:185; Interrogation_Position=2731; Antisense; AAAATCGCTAACTAATACACTGTAA
>probe:Drosophila_2:1628865_at:117:221; Interrogation_Position=2764; Antisense; AAGGGATTGGAAGCTTCGTCGCATA
>probe:Drosophila_2:1628865_at:180:377; Interrogation_Position=2773; Antisense; GAAGCTTCGTCGCATATACGTACAT
>probe:Drosophila_2:1628865_at:603:1; Interrogation_Position=2788; Antisense; ATACGTACATACACTTTCGGCCTTA
>probe:Drosophila_2:1628865_at:707:653; Interrogation_Position=2797; Antisense; TACACTTTCGGCCTTAGATTTCCTC
>probe:Drosophila_2:1628865_at:9:459; Interrogation_Position=2813; Antisense; GATTTCCTCCAGCTTAAGTACGCAG

Paste this into a BLAST search page for me
GAACGAAAGTCGGAAGCTCTTATTTGCTCTTATTTTGATTCGTCTTTGAAAACGTAGTTCTCTAGTTGCAAAACATTAAGCATATTGACTACCTAGCCGTGACTACCTAGCCGTTAAGACTTAGCAATTTTTTGTCGGAGCAGCTTTCATGGAGCAGCTTTCATTCTCGTCATCCATCCGCCAGCTTTCTAGTACAAAAAAAAATCGCTAACTAATACACTGTAAAAGGGATTGGAAGCTTCGTCGCATAGAAGCTTCGTCGCATATACGTACATATACGTACATACACTTTCGGCCTTATACACTTTCGGCCTTAGATTTCCTCGATTTCCTCCAGCTTAAGTACGCAG

Full Affymetrix probeset data:

Annotations for 1628865_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720