FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628866_at:

>probe:Drosophila_2:1628866_at:431:561; Interrogation_Position=3711; Antisense; GGAAGAACCGAAATGCAGTTGCCCA
>probe:Drosophila_2:1628866_at:540:349; Interrogation_Position=3725; Antisense; GCAGTTGCCCACGATAGACAACGAA
>probe:Drosophila_2:1628866_at:227:241; Interrogation_Position=3784; Antisense; AATAAGAGAGAACTCCGCTCCTCGC
>probe:Drosophila_2:1628866_at:123:213; Interrogation_Position=3840; Antisense; AAGACAGTCGTCGTGGTGACCGTTC
>probe:Drosophila_2:1628866_at:566:511; Interrogation_Position=3855; Antisense; GTGACCGTTCCTCCAGAAACGAGAG
>probe:Drosophila_2:1628866_at:562:39; Interrogation_Position=3898; Antisense; ATCGGACCGCGGAGAAAGATCAGAC
>probe:Drosophila_2:1628866_at:517:169; Interrogation_Position=4000; Antisense; AAAGGAACGCAGTCGTGCCAAGGAG
>probe:Drosophila_2:1628866_at:649:33; Interrogation_Position=4047; Antisense; ATCTGAAGGGACAACGGGAGCGTAA
>probe:Drosophila_2:1628866_at:98:103; Interrogation_Position=4075; Antisense; AGAGCGTGACGATGGATCCCGTGAT
>probe:Drosophila_2:1628866_at:649:65; Interrogation_Position=4086; Antisense; ATGGATCCCGTGATCGTTCGCGAAG
>probe:Drosophila_2:1628866_at:609:41; Interrogation_Position=4098; Antisense; ATCGTTCGCGAAGGGAGCGCAGCTC
>probe:Drosophila_2:1628866_at:578:317; Interrogation_Position=4125; Antisense; GCCGTTCCAAGGGACGCAGCTGAAT
>probe:Drosophila_2:1628866_at:466:367; Interrogation_Position=4146; Antisense; GAATCTGGAGACTGGACAACGTGAC
>probe:Drosophila_2:1628866_at:677:159; Interrogation_Position=4161; Antisense; ACAACGTGACGTGACCAACAAAGGC

Paste this into a BLAST search page for me
GGAAGAACCGAAATGCAGTTGCCCAGCAGTTGCCCACGATAGACAACGAAAATAAGAGAGAACTCCGCTCCTCGCAAGACAGTCGTCGTGGTGACCGTTCGTGACCGTTCCTCCAGAAACGAGAGATCGGACCGCGGAGAAAGATCAGACAAAGGAACGCAGTCGTGCCAAGGAGATCTGAAGGGACAACGGGAGCGTAAAGAGCGTGACGATGGATCCCGTGATATGGATCCCGTGATCGTTCGCGAAGATCGTTCGCGAAGGGAGCGCAGCTCGCCGTTCCAAGGGACGCAGCTGAATGAATCTGGAGACTGGACAACGTGACACAACGTGACGTGACCAACAAAGGC

Full Affymetrix probeset data:

Annotations for 1628866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720