Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628868_at:

>probe:Drosophila_2:1628868_at:131:63; Interrogation_Position=2196; Antisense; ATGTGCTGGTGGACTCCTGATTCGA
>probe:Drosophila_2:1628868_at:261:605; Interrogation_Position=2213; Antisense; TGATTCGAGCAGCTGGGCCAGTCAT
>probe:Drosophila_2:1628868_at:455:393; Interrogation_Position=2250; Antisense; GAAAGGCCCTCCGAAAGCTGAGTCT
>probe:Drosophila_2:1628868_at:728:119; Interrogation_Position=2265; Antisense; AGCTGAGTCTCGCTGCGTTCAAGGA
>probe:Drosophila_2:1628868_at:455:131; Interrogation_Position=2289; Antisense; ACCGGTCCCGCGAGAAGAGCTCAAA
>probe:Drosophila_2:1628868_at:407:101; Interrogation_Position=2304; Antisense; AGAGCTCAAAGGAGTCGCGTCTGGA
>probe:Drosophila_2:1628868_at:205:75; Interrogation_Position=2328; Antisense; AGGAGAACGGAGCTCAATTCCATGC
>probe:Drosophila_2:1628868_at:547:719; Interrogation_Position=2345; Antisense; TTCCATGCAGCGGTTGCACTTGATA
>probe:Drosophila_2:1628868_at:34:357; Interrogation_Position=2360; Antisense; GCACTTGATATTGAGCCAGGCCTGG
>probe:Drosophila_2:1628868_at:381:723; Interrogation_Position=2424; Antisense; TTGTTTTTACAAGGTCGATGCCAAA
>probe:Drosophila_2:1628868_at:704:405; Interrogation_Position=2453; Antisense; GACTGCTGTCGTCAAGTGCTTGGCT
>probe:Drosophila_2:1628868_at:401:343; Interrogation_Position=2470; Antisense; GCTTGGCTCAGGATGAGACCGACCA
>probe:Drosophila_2:1628868_at:593:531; Interrogation_Position=2502; Antisense; GGGTCATCCGAACAATCTAGCCTAG
>probe:Drosophila_2:1628868_at:656:249; Interrogation_Position=2514; Antisense; CAATCTAGCCTAGACTGGGCCATAA

Paste this into a BLAST search page for me
ATGTGCTGGTGGACTCCTGATTCGATGATTCGAGCAGCTGGGCCAGTCATGAAAGGCCCTCCGAAAGCTGAGTCTAGCTGAGTCTCGCTGCGTTCAAGGAACCGGTCCCGCGAGAAGAGCTCAAAAGAGCTCAAAGGAGTCGCGTCTGGAAGGAGAACGGAGCTCAATTCCATGCTTCCATGCAGCGGTTGCACTTGATAGCACTTGATATTGAGCCAGGCCTGGTTGTTTTTACAAGGTCGATGCCAAAGACTGCTGTCGTCAAGTGCTTGGCTGCTTGGCTCAGGATGAGACCGACCAGGGTCATCCGAACAATCTAGCCTAGCAATCTAGCCTAGACTGGGCCATAA

Full Affymetrix probeset data:

Annotations for 1628868_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime