Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628871_at:

>probe:Drosophila_2:1628871_at:444:591; Interrogation_Position=123; Antisense; TGGTGTACTACATGCAGCCGCTAAT
>probe:Drosophila_2:1628871_at:405:353; Interrogation_Position=151; Antisense; GCACCTGTTCGACACCTGGATGCAA
>probe:Drosophila_2:1628871_at:528:651; Interrogation_Position=198; Antisense; TCAAGTTCATCTACAGCTGGGTGCT
>probe:Drosophila_2:1628871_at:261:335; Interrogation_Position=220; Antisense; GCTGATCTTCTTCATCATGATTCCG
>probe:Drosophila_2:1628871_at:670:35; Interrogation_Position=233; Antisense; ATCATGATTCCGATGCTCTATCCGC
>probe:Drosophila_2:1628871_at:48:671; Interrogation_Position=278; Antisense; TACGGCATATTCCAGTACGCGGCGG
>probe:Drosophila_2:1628871_at:71:107; Interrogation_Position=306; Antisense; AGCACTTCGGACTGAAGACGCCCGA
>probe:Drosophila_2:1628871_at:243:309; Interrogation_Position=357; Antisense; CCAGGCTGTGGCACTTCGAGGTGAC
>probe:Drosophila_2:1628871_at:602:217; Interrogation_Position=389; Antisense; AAGTATCTCCTTCGACTATATGCGC
>probe:Drosophila_2:1628871_at:548:337; Interrogation_Position=417; Antisense; GCTCTGTGGTTCGTCTTCAACTGAA
>probe:Drosophila_2:1628871_at:270:193; Interrogation_Position=435; Antisense; AACTGAACCAACAGCCGGAGTCCTT
>probe:Drosophila_2:1628871_at:185:429; Interrogation_Position=491; Antisense; GAGTTGGCTTAGTAACTGCCTTTGG
>probe:Drosophila_2:1628871_at:433:227; Interrogation_Position=71; Antisense; AAGGCGTTCCACAAGCGCAAGCTGT
>probe:Drosophila_2:1628871_at:542:75; Interrogation_Position=98; Antisense; AGGAGCGTGTCCAAGCCCGGAAAGC

Paste this into a BLAST search page for me
TGGTGTACTACATGCAGCCGCTAATGCACCTGTTCGACACCTGGATGCAATCAAGTTCATCTACAGCTGGGTGCTGCTGATCTTCTTCATCATGATTCCGATCATGATTCCGATGCTCTATCCGCTACGGCATATTCCAGTACGCGGCGGAGCACTTCGGACTGAAGACGCCCGACCAGGCTGTGGCACTTCGAGGTGACAAGTATCTCCTTCGACTATATGCGCGCTCTGTGGTTCGTCTTCAACTGAAAACTGAACCAACAGCCGGAGTCCTTGAGTTGGCTTAGTAACTGCCTTTGGAAGGCGTTCCACAAGCGCAAGCTGTAGGAGCGTGTCCAAGCCCGGAAAGC

Full Affymetrix probeset data:

Annotations for 1628871_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime