FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628872_at:

>probe:Drosophila_2:1628872_at:314:273; Interrogation_Position=1510; Antisense; CATTGGCACCTGCTCGGGATATATG
>probe:Drosophila_2:1628872_at:684:279; Interrogation_Position=1522; Antisense; CTCGGGATATATGCGCCAAGCGTTG
>probe:Drosophila_2:1628872_at:470:309; Interrogation_Position=1537; Antisense; CCAAGCGTTGGATGAGGCTGCCTGT
>probe:Drosophila_2:1628872_at:515:531; Interrogation_Position=1563; Antisense; GGGTGTTTACCAACTCTGAGATCCT
>probe:Drosophila_2:1628872_at:570:585; Interrogation_Position=1720; Antisense; TGGACGTCCTTGCAAAGCTGCCGCT
>probe:Drosophila_2:1628872_at:24:449; Interrogation_Position=1787; Antisense; GATGCCACCAACGTGATGATCACAC
>probe:Drosophila_2:1628872_at:280:79; Interrogation_Position=1839; Antisense; AGGGCATGGCCGGACGTCCAACAAG
>probe:Drosophila_2:1628872_at:410:43; Interrogation_Position=1871; Antisense; ATCGAGTTTATTGCACAGTCCATAT
>probe:Drosophila_2:1628872_at:31:55; Interrogation_Position=1894; Antisense; ATGCAAGGACACAGCTCCAAAGCTT
>probe:Drosophila_2:1628872_at:662:47; Interrogation_Position=1960; Antisense; ATGCCACACGTTCATCGGTATTCTT
>probe:Drosophila_2:1628872_at:65:687; Interrogation_Position=1978; Antisense; TATTCTTTTAACGACTGACCAACCT
>probe:Drosophila_2:1628872_at:415:1; Interrogation_Position=1991; Antisense; ACTGACCAACCTATGACTTCTTTAA
>probe:Drosophila_2:1628872_at:695:681; Interrogation_Position=2002; Antisense; TATGACTTCTTTAACGTTCTGACGT
>probe:Drosophila_2:1628872_at:128:285; Interrogation_Position=2020; Antisense; CTGACGTTTATCTAATTGGGACCAC

Paste this into a BLAST search page for me
CATTGGCACCTGCTCGGGATATATGCTCGGGATATATGCGCCAAGCGTTGCCAAGCGTTGGATGAGGCTGCCTGTGGGTGTTTACCAACTCTGAGATCCTTGGACGTCCTTGCAAAGCTGCCGCTGATGCCACCAACGTGATGATCACACAGGGCATGGCCGGACGTCCAACAAGATCGAGTTTATTGCACAGTCCATATATGCAAGGACACAGCTCCAAAGCTTATGCCACACGTTCATCGGTATTCTTTATTCTTTTAACGACTGACCAACCTACTGACCAACCTATGACTTCTTTAATATGACTTCTTTAACGTTCTGACGTCTGACGTTTATCTAATTGGGACCAC

Full Affymetrix probeset data:

Annotations for 1628872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720