FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628874_at:

>probe:Drosophila_2:1628874_at:661:47; Interrogation_Position=130; Antisense; ATCCAGCCATGTCGAACGGTTTTTC
>probe:Drosophila_2:1628874_at:700:697; Interrogation_Position=149; Antisense; TTTTTCCTTCTGGAACGGACAGCCA
>probe:Drosophila_2:1628874_at:377:559; Interrogation_Position=165; Antisense; GGACAGCCAGTGAATGCGCCTATCT
>probe:Drosophila_2:1628874_at:645:195; Interrogation_Position=213; Antisense; AACGTTGGTAGCCAGTGGTCGTCCA
>probe:Drosophila_2:1628874_at:100:521; Interrogation_Position=240; Antisense; GTGGCACCAGGATCCTGTGGACCAA
>probe:Drosophila_2:1628874_at:590:519; Interrogation_Position=256; Antisense; GTGGACCAAGAACTCGACCGATGCT
>probe:Drosophila_2:1628874_at:128:621; Interrogation_Position=277; Antisense; TGCTGCAGAGCATGGGCGATTTCCA
>probe:Drosophila_2:1628874_at:281:459; Interrogation_Position=294; Antisense; GATTTCCAGCCGATGAGATGTCCTC
>probe:Drosophila_2:1628874_at:566:125; Interrogation_Position=343; Antisense; AGCCGCACGCCATGGGAACTGGATT
>probe:Drosophila_2:1628874_at:41:19; Interrogation_Position=365; Antisense; ATTTGGAGATGATCAGGGACCCTGC
>probe:Drosophila_2:1628874_at:348:281; Interrogation_Position=386; Antisense; CTGCGAACCCTGCATCGATAATGGA
>probe:Drosophila_2:1628874_at:481:539; Interrogation_Position=475; Antisense; GGTAGTAAATCAGTTGTCCCATCCA
>probe:Drosophila_2:1628874_at:176:413; Interrogation_Position=501; Antisense; GACCTTCTTGTTCACAAAGTCGTTG
>probe:Drosophila_2:1628874_at:326:595; Interrogation_Position=541; Antisense; TGTGGTCTCTGCTAGCTCAAACATA

Paste this into a BLAST search page for me
ATCCAGCCATGTCGAACGGTTTTTCTTTTTCCTTCTGGAACGGACAGCCAGGACAGCCAGTGAATGCGCCTATCTAACGTTGGTAGCCAGTGGTCGTCCAGTGGCACCAGGATCCTGTGGACCAAGTGGACCAAGAACTCGACCGATGCTTGCTGCAGAGCATGGGCGATTTCCAGATTTCCAGCCGATGAGATGTCCTCAGCCGCACGCCATGGGAACTGGATTATTTGGAGATGATCAGGGACCCTGCCTGCGAACCCTGCATCGATAATGGAGGTAGTAAATCAGTTGTCCCATCCAGACCTTCTTGTTCACAAAGTCGTTGTGTGGTCTCTGCTAGCTCAAACATA

Full Affymetrix probeset data:

Annotations for 1628874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720