Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628875_at:

>probe:Drosophila_2:1628875_at:24:703; Interrogation_Position=2477; Antisense; TTATTCCAATGAGCGATCCCTTCGA
>probe:Drosophila_2:1628875_at:403:447; Interrogation_Position=2491; Antisense; GATCCCTTCGAAATGAGGACCCTTA
>probe:Drosophila_2:1628875_at:544:209; Interrogation_Position=2515; Antisense; AAGAAGGCTAGCTTTCAGCAATTGC
>probe:Drosophila_2:1628875_at:273:111; Interrogation_Position=2531; Antisense; AGCAATTGCCCCTGAGTGCTGCAGT
>probe:Drosophila_2:1628875_at:454:349; Interrogation_Position=2551; Antisense; GCAGTGCCCCAGAAGAAGCTGTTGG
>probe:Drosophila_2:1628875_at:723:377; Interrogation_Position=2565; Antisense; GAAGCTGTTGGATCCACCGCTTAGA
>probe:Drosophila_2:1628875_at:543:603; Interrogation_Position=2605; Antisense; TGTTCCCTGCTCACCGGAAAGTGCT
>probe:Drosophila_2:1628875_at:334:171; Interrogation_Position=2622; Antisense; AAAGTGCTCCCAGATGAGCGGCCGG
>probe:Drosophila_2:1628875_at:604:539; Interrogation_Position=2651; Antisense; TCAAACGGGCCCTCGAGGTAATCGA
>probe:Drosophila_2:1628875_at:677:267; Interrogation_Position=2707; Antisense; CAGGAACAGATCAACGACAGTCGAC
>probe:Drosophila_2:1628875_at:144:401; Interrogation_Position=2722; Antisense; GACAGTCGACTGAAGCTGATCGAGT
>probe:Drosophila_2:1628875_at:720:283; Interrogation_Position=2737; Antisense; CTGATCGAGTACAAGCTGGAGCAAT
>probe:Drosophila_2:1628875_at:398:361; Interrogation_Position=2757; Antisense; GCAATTAATACAGCTGGTCCAGGAC
>probe:Drosophila_2:1628875_at:213:669; Interrogation_Position=3006; Antisense; TACTGTACTATTTGTACCCGAGTAA

Paste this into a BLAST search page for me
TTATTCCAATGAGCGATCCCTTCGAGATCCCTTCGAAATGAGGACCCTTAAAGAAGGCTAGCTTTCAGCAATTGCAGCAATTGCCCCTGAGTGCTGCAGTGCAGTGCCCCAGAAGAAGCTGTTGGGAAGCTGTTGGATCCACCGCTTAGATGTTCCCTGCTCACCGGAAAGTGCTAAAGTGCTCCCAGATGAGCGGCCGGTCAAACGGGCCCTCGAGGTAATCGACAGGAACAGATCAACGACAGTCGACGACAGTCGACTGAAGCTGATCGAGTCTGATCGAGTACAAGCTGGAGCAATGCAATTAATACAGCTGGTCCAGGACTACTGTACTATTTGTACCCGAGTAA

Full Affymetrix probeset data:

Annotations for 1628875_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime