FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628879_at:

>probe:Drosophila_2:1628879_at:256:571; Interrogation_Position=1012; Antisense; GGCTTAGCCGTCTATATGATTGCGC
>probe:Drosophila_2:1628879_at:305:449; Interrogation_Position=1038; Antisense; GATCCTAATGATTCCTGTGGCTACA
>probe:Drosophila_2:1628879_at:360:603; Interrogation_Position=1064; Antisense; TGATATTTTTTCTCACGCGCACTGA
>probe:Drosophila_2:1628879_at:655:77; Interrogation_Position=1108; Antisense; AGGTTTACATCTGGCGTGGGTTTCA
>probe:Drosophila_2:1628879_at:536:605; Interrogation_Position=1148; Antisense; TGATCTTCTGCTTAACCACCGAGGT
>probe:Drosophila_2:1628879_at:470:57; Interrogation_Position=1180; Antisense; ATGTTCTTTACGATGGCGACCATAT
>probe:Drosophila_2:1628879_at:259:493; Interrogation_Position=1210; Antisense; GTAAGCCAGGAATTCTCACTTGCCA
>probe:Drosophila_2:1628879_at:602:141; Interrogation_Position=1234; Antisense; ACGGCCATTTGCTGGGCACTAAGTA
>probe:Drosophila_2:1628879_at:416:35; Interrogation_Position=1292; Antisense; ATCAGGGATGGCCTCGCATGGCAAT
>probe:Drosophila_2:1628879_at:573:19; Interrogation_Position=1341; Antisense; ATTTGCATCCTTTGTTTTCTTGGCC
>probe:Drosophila_2:1628879_at:45:105; Interrogation_Position=1436; Antisense; AGACGGTTTGCATCTTCTTGGAGGT
>probe:Drosophila_2:1628879_at:106:15; Interrogation_Position=1477; Antisense; ATGCTTTCCGTACTAACCACAAACT
>probe:Drosophila_2:1628879_at:391:473; Interrogation_Position=1534; Antisense; GTTTCCTACTACATTTTCTTCGTGG
>probe:Drosophila_2:1628879_at:175:643; Interrogation_Position=1550; Antisense; TCTTCGTGGGAGTTCTAATTCTGCT

Paste this into a BLAST search page for me
GGCTTAGCCGTCTATATGATTGCGCGATCCTAATGATTCCTGTGGCTACATGATATTTTTTCTCACGCGCACTGAAGGTTTACATCTGGCGTGGGTTTCATGATCTTCTGCTTAACCACCGAGGTATGTTCTTTACGATGGCGACCATATGTAAGCCAGGAATTCTCACTTGCCAACGGCCATTTGCTGGGCACTAAGTAATCAGGGATGGCCTCGCATGGCAATATTTGCATCCTTTGTTTTCTTGGCCAGACGGTTTGCATCTTCTTGGAGGTATGCTTTCCGTACTAACCACAAACTGTTTCCTACTACATTTTCTTCGTGGTCTTCGTGGGAGTTCTAATTCTGCT

Full Affymetrix probeset data:

Annotations for 1628879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720