FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628882_at:

>probe:Drosophila_2:1628882_at:432:529; Interrogation_Position=1095; Antisense; GGGATCCGGCAACTAACCAAATGAA
>probe:Drosophila_2:1628882_at:266:537; Interrogation_Position=650; Antisense; GGTCAGGTGGACACTGGACACAGCT
>probe:Drosophila_2:1628882_at:553:585; Interrogation_Position=664; Antisense; TGGACACAGCTACTACCGGGATATG
>probe:Drosophila_2:1628882_at:496:529; Interrogation_Position=681; Antisense; GGGATATGCCCAGCATCAGGTACAT
>probe:Drosophila_2:1628882_at:421:115; Interrogation_Position=692; Antisense; AGCATCAGGTACATGGGCTTCCCCA
>probe:Drosophila_2:1628882_at:143:591; Interrogation_Position=717; Antisense; TGGTCGATGCCCCAACGACAGACAT
>probe:Drosophila_2:1628882_at:44:107; Interrogation_Position=736; Antisense; AGACATCTCGCGCTACTTCTACGTG
>probe:Drosophila_2:1628882_at:634:635; Interrogation_Position=753; Antisense; TCTACGTGGCCTCCAAGTTCATCGA
>probe:Drosophila_2:1628882_at:444:217; Interrogation_Position=767; Antisense; AAGTTCATCGACAGCGCCATCAGCA
>probe:Drosophila_2:1628882_at:58:317; Interrogation_Position=854; Antisense; GCCTACCTGATGATCTGCCGGAAGA
>probe:Drosophila_2:1628882_at:364:607; Interrogation_Position=912; Antisense; TGAGGCGCGATATCCGGCCGAATGA
>probe:Drosophila_2:1628882_at:697:57; Interrogation_Position=933; Antisense; ATGATGGATTCCTGCAGCAACTGGC
>probe:Drosophila_2:1628882_at:67:553; Interrogation_Position=970; Antisense; GGAGCTCAAGCGCAAGAACCTGTAT
>probe:Drosophila_2:1628882_at:604:379; Interrogation_Position=985; Antisense; GAACCTGTATCCCTACTAGTACGAT

Paste this into a BLAST search page for me
GGGATCCGGCAACTAACCAAATGAAGGTCAGGTGGACACTGGACACAGCTTGGACACAGCTACTACCGGGATATGGGGATATGCCCAGCATCAGGTACATAGCATCAGGTACATGGGCTTCCCCATGGTCGATGCCCCAACGACAGACATAGACATCTCGCGCTACTTCTACGTGTCTACGTGGCCTCCAAGTTCATCGAAAGTTCATCGACAGCGCCATCAGCAGCCTACCTGATGATCTGCCGGAAGATGAGGCGCGATATCCGGCCGAATGAATGATGGATTCCTGCAGCAACTGGCGGAGCTCAAGCGCAAGAACCTGTATGAACCTGTATCCCTACTAGTACGAT

Full Affymetrix probeset data:

Annotations for 1628882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720