FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628883_at:

>probe:Drosophila_2:1628883_at:225:245; Interrogation_Position=117; Antisense; AATTCAAGCCGAATTGACGGCCGCC
>probe:Drosophila_2:1628883_at:721:303; Interrogation_Position=171; Antisense; CCAGTTAATGTGTTCCAGTTGCGAA
>probe:Drosophila_2:1628883_at:724:3; Interrogation_Position=213; Antisense; ATTGGATACCATCAAGCCTCAGTGT
>probe:Drosophila_2:1628883_at:411:433; Interrogation_Position=301; Antisense; GAGGTGTGCACCTGCAAATTCCGGG
>probe:Drosophila_2:1628883_at:107:683; Interrogation_Position=328; Antisense; TATCCGCAGATTCAGGCCTTTATTC
>probe:Drosophila_2:1628883_at:678:271; Interrogation_Position=343; Antisense; GCCTTTATTCAAAGCGGCCGACCTG
>probe:Drosophila_2:1628883_at:594:93; Interrogation_Position=371; Antisense; AGTTCCCCAACCTGCAGATCAAATA
>probe:Drosophila_2:1628883_at:239:143; Interrogation_Position=405; Antisense; ACTGGATCCCGTGGTTAAGCTCCTA
>probe:Drosophila_2:1628883_at:142:711; Interrogation_Position=419; Antisense; TTAAGCTCCTAGATGCCAGTGGCAA
>probe:Drosophila_2:1628883_at:171:549; Interrogation_Position=450; Antisense; GGAGACGTTGTCCATAACCAAGTGG
>probe:Drosophila_2:1628883_at:430:429; Interrogation_Position=493; Antisense; GAGTTCTTCGAAACGCATCTGGCCA
>probe:Drosophila_2:1628883_at:147:507; Interrogation_Position=524; Antisense; GTGCCGGCAAGAATTCGTACAGCGT
>probe:Drosophila_2:1628883_at:551:409; Interrogation_Position=571; Antisense; GACGATGAAGATTACCTGCGAACCA
>probe:Drosophila_2:1628883_at:420:597; Interrogation_Position=79; Antisense; TGTGCTATATTTCTTCTACTGGCTT

Paste this into a BLAST search page for me
AATTCAAGCCGAATTGACGGCCGCCCCAGTTAATGTGTTCCAGTTGCGAAATTGGATACCATCAAGCCTCAGTGTGAGGTGTGCACCTGCAAATTCCGGGTATCCGCAGATTCAGGCCTTTATTCGCCTTTATTCAAAGCGGCCGACCTGAGTTCCCCAACCTGCAGATCAAATAACTGGATCCCGTGGTTAAGCTCCTATTAAGCTCCTAGATGCCAGTGGCAAGGAGACGTTGTCCATAACCAAGTGGGAGTTCTTCGAAACGCATCTGGCCAGTGCCGGCAAGAATTCGTACAGCGTGACGATGAAGATTACCTGCGAACCATGTGCTATATTTCTTCTACTGGCTT

Full Affymetrix probeset data:

Annotations for 1628883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720