Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628884_at:

>probe:Drosophila_2:1628884_at:392:503; Interrogation_Position=1007; Antisense; GTCCCGGACTGACTCTATACAACGA
>probe:Drosophila_2:1628884_at:726:197; Interrogation_Position=1027; Antisense; AACGAGATCCAAGAGTGGCCGCACT
>probe:Drosophila_2:1628884_at:227:143; Interrogation_Position=1049; Antisense; ACTGGCTCTCAAATCCCTAAATCAA
>probe:Drosophila_2:1628884_at:84:467; Interrogation_Position=609; Antisense; GTTGGGACTCCACTACCAAGTGCGT
>probe:Drosophila_2:1628884_at:108:221; Interrogation_Position=626; Antisense; AAGTGCGTCCCATCCGCTATGTGGT
>probe:Drosophila_2:1628884_at:342:681; Interrogation_Position=643; Antisense; TATGTGGTCATCCATCACACGGTCA
>probe:Drosophila_2:1628884_at:621:121; Interrogation_Position=679; Antisense; AGCGGACTGCTCAAGTGCGCCGAGA
>probe:Drosophila_2:1628884_at:415:463; Interrogation_Position=702; Antisense; GATTCTCCAGAACATGCAGGCGTAT
>probe:Drosophila_2:1628884_at:214:383; Interrogation_Position=732; Antisense; GAACGAGCTGGACTTCAACGATATT
>probe:Drosophila_2:1628884_at:457:535; Interrogation_Position=820; Antisense; GGTGCCCACACCTATGGATACAATG
>probe:Drosophila_2:1628884_at:529:3; Interrogation_Position=847; Antisense; ATTGGCACGGGCATAGCCTTTATCG
>probe:Drosophila_2:1628884_at:618:315; Interrogation_Position=862; Antisense; GCCTTTATCGGCAACTTTGTGGATA
>probe:Drosophila_2:1628884_at:261:31; Interrogation_Position=884; Antisense; ATAAACTTCCATCGGATGCGGCTCT
>probe:Drosophila_2:1628884_at:285:257; Interrogation_Position=918; Antisense; CAAAGATCTGCTGGCCTGCGGAGTG

Paste this into a BLAST search page for me
GTCCCGGACTGACTCTATACAACGAAACGAGATCCAAGAGTGGCCGCACTACTGGCTCTCAAATCCCTAAATCAAGTTGGGACTCCACTACCAAGTGCGTAAGTGCGTCCCATCCGCTATGTGGTTATGTGGTCATCCATCACACGGTCAAGCGGACTGCTCAAGTGCGCCGAGAGATTCTCCAGAACATGCAGGCGTATGAACGAGCTGGACTTCAACGATATTGGTGCCCACACCTATGGATACAATGATTGGCACGGGCATAGCCTTTATCGGCCTTTATCGGCAACTTTGTGGATAATAAACTTCCATCGGATGCGGCTCTCAAAGATCTGCTGGCCTGCGGAGTG

Full Affymetrix probeset data:

Annotations for 1628884_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime