Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628885_at:

>probe:Drosophila_2:1628885_at:589:441; Interrogation_Position=1165; Antisense; GATGGATCCACAACGGCACCTGCCT
>probe:Drosophila_2:1628885_at:401:179; Interrogation_Position=1196; Antisense; AAACAGTCACCTGGGTGGTGCTCAA
>probe:Drosophila_2:1628885_at:569:321; Interrogation_Position=1224; Antisense; GCCCATCTACATCACAAAGCAACAG
>probe:Drosophila_2:1628885_at:34:391; Interrogation_Position=1293; Antisense; GAAAGCGCCCCTGGGCAACAATTAC
>probe:Drosophila_2:1628885_at:655:577; Interrogation_Position=1343; Antisense; GGCCCATTCGCACCAATATTGATTT
>probe:Drosophila_2:1628885_at:723:295; Interrogation_Position=1373; Antisense; CGACGAAGTCGAACGGCAAGGCCGC
>probe:Drosophila_2:1628885_at:496:127; Interrogation_Position=1405; Antisense; ACCATGTACCGCGAGGTCTACTATA
>probe:Drosophila_2:1628885_at:417:497; Interrogation_Position=1420; Antisense; GTCTACTATAAAGCGACCAGTTGGA
>probe:Drosophila_2:1628885_at:294:263; Interrogation_Position=1460; Antisense; CAGCGACGTGATGTCGTAACGTAAC
>probe:Drosophila_2:1628885_at:144:485; Interrogation_Position=1502; Antisense; GTATGACGTAAGTAGCGAGCGGCAT
>probe:Drosophila_2:1628885_at:118:417; Interrogation_Position=1518; Antisense; GAGCGGCATGCAACAGGAGCTTCCA
>probe:Drosophila_2:1628885_at:38:553; Interrogation_Position=1533; Antisense; GGAGCTTCCACTAAACATACATATA
>probe:Drosophila_2:1628885_at:584:169; Interrogation_Position=1644; Antisense; AAAGGAATCAGTGCAGCAGCGGCCA
>probe:Drosophila_2:1628885_at:406:575; Interrogation_Position=1675; Antisense; GGCGATTGGAATTACACACATCTAT

Paste this into a BLAST search page for me
GATGGATCCACAACGGCACCTGCCTAAACAGTCACCTGGGTGGTGCTCAAGCCCATCTACATCACAAAGCAACAGGAAAGCGCCCCTGGGCAACAATTACGGCCCATTCGCACCAATATTGATTTCGACGAAGTCGAACGGCAAGGCCGCACCATGTACCGCGAGGTCTACTATAGTCTACTATAAAGCGACCAGTTGGACAGCGACGTGATGTCGTAACGTAACGTATGACGTAAGTAGCGAGCGGCATGAGCGGCATGCAACAGGAGCTTCCAGGAGCTTCCACTAAACATACATATAAAAGGAATCAGTGCAGCAGCGGCCAGGCGATTGGAATTACACACATCTAT

Full Affymetrix probeset data:

Annotations for 1628885_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime