Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628886_at:

>probe:Drosophila_2:1628886_at:488:401; Interrogation_Position=103; Antisense; GACTTGTTGGCAGCCTTGAACTCGG
>probe:Drosophila_2:1628886_at:620:463; Interrogation_Position=108; Antisense; GTTGGCAGCCTTGAACTCGGCGGTT
>probe:Drosophila_2:1628886_at:697:723; Interrogation_Position=118; Antisense; TTGAACTCGGCGGTTGCGGAGCAAC
>probe:Drosophila_2:1628886_at:594:69; Interrogation_Position=13; Antisense; ATGGCCAGTCACTTCGGCGGGCCAA
>probe:Drosophila_2:1628886_at:368:311; Interrogation_Position=33; Antisense; GCCAAGGTCATCCAGAGCTCTCATT
>probe:Drosophila_2:1628886_at:613:223; Interrogation_Position=36; Antisense; AAGGTCATCCAGAGCTCTCATTCAG
>probe:Drosophila_2:1628886_at:226:497; Interrogation_Position=39; Antisense; GTCATCCAGAGCTCTCATTCAGGGT
>probe:Drosophila_2:1628886_at:220:103; Interrogation_Position=46; Antisense; AGAGCTCTCATTCAGGGTCGCAAGT
>probe:Drosophila_2:1628886_at:507:641; Interrogation_Position=51; Antisense; TCTCATTCAGGGTCGCAAGTCCTTC
>probe:Drosophila_2:1628886_at:536:647; Interrogation_Position=57; Antisense; TCAGGGTCGCAAGTCCTTCGTCCTT
>probe:Drosophila_2:1628886_at:154:717; Interrogation_Position=73; Antisense; TTCGTCCTTCCTACCTGCTTCAAAG
>probe:Drosophila_2:1628886_at:405:617; Interrogation_Position=88; Antisense; TGCTTCAAAGCCACCGACTTGTTGG
>probe:Drosophila_2:1628886_at:702:173; Interrogation_Position=94; Antisense; AAAGCCACCGACTTGTTGGCAGCCT
>probe:Drosophila_2:1628886_at:488:309; Interrogation_Position=98; Antisense; CCACCGACTTGTTGGCAGCCTTGAA

Paste this into a BLAST search page for me
GACTTGTTGGCAGCCTTGAACTCGGGTTGGCAGCCTTGAACTCGGCGGTTTTGAACTCGGCGGTTGCGGAGCAACATGGCCAGTCACTTCGGCGGGCCAAGCCAAGGTCATCCAGAGCTCTCATTAAGGTCATCCAGAGCTCTCATTCAGGTCATCCAGAGCTCTCATTCAGGGTAGAGCTCTCATTCAGGGTCGCAAGTTCTCATTCAGGGTCGCAAGTCCTTCTCAGGGTCGCAAGTCCTTCGTCCTTTTCGTCCTTCCTACCTGCTTCAAAGTGCTTCAAAGCCACCGACTTGTTGGAAAGCCACCGACTTGTTGGCAGCCTCCACCGACTTGTTGGCAGCCTTGAA

Full Affymetrix probeset data:

Annotations for 1628886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime