FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628890_at:

>probe:Drosophila_2:1628890_at:168:695; Interrogation_Position=8347; Antisense; TTTGCCTACGCCAACATAATGGATC
>probe:Drosophila_2:1628890_at:354:359; Interrogation_Position=8397; Antisense; GCAACATTTCCAGCATAACCTGCAG
>probe:Drosophila_2:1628890_at:479:57; Interrogation_Position=8450; Antisense; ATGTTAGCCACATGGGCGGAGCAGC
>probe:Drosophila_2:1628890_at:10:39; Interrogation_Position=8530; Antisense; ATCGACAGCATCCTGAACTTGCAGA
>probe:Drosophila_2:1628890_at:179:717; Interrogation_Position=8586; Antisense; TTCGATCCTCGGTGACAGCATGCTG
>probe:Drosophila_2:1628890_at:711:207; Interrogation_Position=8624; Antisense; AAGCAGGAGCCAATTTGCCCAGCTG
>probe:Drosophila_2:1628890_at:227:383; Interrogation_Position=8697; Antisense; GAACGACTGCCTGATTAGCGGCGGT
>probe:Drosophila_2:1628890_at:679:433; Interrogation_Position=8738; Antisense; GAGTGGCGGACAACAGTAGTAACAT
>probe:Drosophila_2:1628890_at:98:493; Interrogation_Position=8756; Antisense; GTAACATACTGCTAGAGCACCACCA
>probe:Drosophila_2:1628890_at:552:345; Interrogation_Position=8787; Antisense; GCATCAGTTGATGCAGAGCCACCAA
>probe:Drosophila_2:1628890_at:156:357; Interrogation_Position=8868; Antisense; GCACATGGGACAGCTGAACGACTTT
>probe:Drosophila_2:1628890_at:535:381; Interrogation_Position=8883; Antisense; GAACGACTTTAGCTGTGTAGCCGGT
>probe:Drosophila_2:1628890_at:252:675; Interrogation_Position=8900; Antisense; TAGCCGGTGGCTTGGACGATCCTGT
>probe:Drosophila_2:1628890_at:15:585; Interrogation_Position=8912; Antisense; TGGACGATCCTGTCAAGTCGATAAT

Paste this into a BLAST search page for me
TTTGCCTACGCCAACATAATGGATCGCAACATTTCCAGCATAACCTGCAGATGTTAGCCACATGGGCGGAGCAGCATCGACAGCATCCTGAACTTGCAGATTCGATCCTCGGTGACAGCATGCTGAAGCAGGAGCCAATTTGCCCAGCTGGAACGACTGCCTGATTAGCGGCGGTGAGTGGCGGACAACAGTAGTAACATGTAACATACTGCTAGAGCACCACCAGCATCAGTTGATGCAGAGCCACCAAGCACATGGGACAGCTGAACGACTTTGAACGACTTTAGCTGTGTAGCCGGTTAGCCGGTGGCTTGGACGATCCTGTTGGACGATCCTGTCAAGTCGATAAT

Full Affymetrix probeset data:

Annotations for 1628890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720