Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628893_at:

>probe:Drosophila_2:1628893_at:502:615; Interrogation_Position=2063; Antisense; TGAAGGACCTCGAGAACCCGGCAAT
>probe:Drosophila_2:1628893_at:722:401; Interrogation_Position=2104; Antisense; GACATCAACAAACTGGTCCAGGCCC
>probe:Drosophila_2:1628893_at:290:505; Interrogation_Position=2119; Antisense; GTCCAGGCCCGCAAGCTGGCGTAGA
>probe:Drosophila_2:1628893_at:177:467; Interrogation_Position=2146; Antisense; GGGTCTAAAGGTCTCGGAGCCATCT
>probe:Drosophila_2:1628893_at:562:639; Interrogation_Position=2159; Antisense; TCGGAGCCATCTCTCGGACGGTATG
>probe:Drosophila_2:1628893_at:663:549; Interrogation_Position=2210; Antisense; GGAGTCACGTCAAAAGTCCGTCTGA
>probe:Drosophila_2:1628893_at:703:521; Interrogation_Position=2257; Antisense; GGGCGGTGTAATTATGCAAATCGTA
>probe:Drosophila_2:1628893_at:529:457; Interrogation_Position=2292; Antisense; GATAGCCTAGCCATATATAGAGGTT
>probe:Drosophila_2:1628893_at:147:99; Interrogation_Position=2310; Antisense; AGAGGTTCGTCAGACGGCAGCTGTC
>probe:Drosophila_2:1628893_at:401:525; Interrogation_Position=2372; Antisense; GGGCTTCATTAATACGCTGTAAATA
>probe:Drosophila_2:1628893_at:387:485; Interrogation_Position=2411; Antisense; GTAGTTTAATTAGCACCAGCACCAA
>probe:Drosophila_2:1628893_at:607:127; Interrogation_Position=2431; Antisense; ACCAATTACTGGAGGATGCTGTTAT
>probe:Drosophila_2:1628893_at:202:91; Interrogation_Position=2480; Antisense; AGTATTTATTTCTAGCCTACGACTA
>probe:Drosophila_2:1628893_at:646:461; Interrogation_Position=2557; Antisense; GATTAGTCAGCGAGCATTGTTCAAT

Paste this into a BLAST search page for me
TGAAGGACCTCGAGAACCCGGCAATGACATCAACAAACTGGTCCAGGCCCGTCCAGGCCCGCAAGCTGGCGTAGAGGGTCTAAAGGTCTCGGAGCCATCTTCGGAGCCATCTCTCGGACGGTATGGGAGTCACGTCAAAAGTCCGTCTGAGGGCGGTGTAATTATGCAAATCGTAGATAGCCTAGCCATATATAGAGGTTAGAGGTTCGTCAGACGGCAGCTGTCGGGCTTCATTAATACGCTGTAAATAGTAGTTTAATTAGCACCAGCACCAAACCAATTACTGGAGGATGCTGTTATAGTATTTATTTCTAGCCTACGACTAGATTAGTCAGCGAGCATTGTTCAAT

Full Affymetrix probeset data:

Annotations for 1628893_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime