FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628895_at:

>probe:Drosophila_2:1628895_at:327:433; Interrogation_Position=114; Antisense; GAGTGCCAGGAGTCAGGGCTTCAAT
>probe:Drosophila_2:1628895_at:462:523; Interrogation_Position=129; Antisense; GGGCTTCAATCCACTGTCTGAACAA
>probe:Drosophila_2:1628895_at:343:159; Interrogation_Position=150; Antisense; ACAAATCGAGGATTCATTCGCCGCC
>probe:Drosophila_2:1628895_at:159:707; Interrogation_Position=184; Antisense; TTACCGCAGCAGGAGCCCGTGGAAG
>probe:Drosophila_2:1628895_at:293:299; Interrogation_Position=215; Antisense; CGCCGAGGCGGGATCATCTTGATAT
>probe:Drosophila_2:1628895_at:131:687; Interrogation_Position=237; Antisense; TATACAGGATCAGGAGCTACTTCAC
>probe:Drosophila_2:1628895_at:146:25; Interrogation_Position=27; Antisense; ATATGTCATATCAGGCTCCGGAGGC
>probe:Drosophila_2:1628895_at:393:623; Interrogation_Position=422; Antisense; TGCGTAGGCGCGAACCAGTCTGTGA
>probe:Drosophila_2:1628895_at:342:267; Interrogation_Position=437; Antisense; CAGTCTGTGAGCTGGACATCCGTGA
>probe:Drosophila_2:1628895_at:120:153; Interrogation_Position=452; Antisense; ACATCCGTGATAGTGGTGGCGTCTA
>probe:Drosophila_2:1628895_at:123:549; Interrogation_Position=46; Antisense; GGAGGCGACGACTTCGATCCAAGTG
>probe:Drosophila_2:1628895_at:560:251; Interrogation_Position=543; Antisense; CAACGATCCTCAGCTGGCCTGGAAG
>probe:Drosophila_2:1628895_at:277:377; Interrogation_Position=564; Antisense; GAAGAAGCACAAATCCCATGCCTGA
>probe:Drosophila_2:1628895_at:333:221; Interrogation_Position=66; Antisense; AAGTGCAAGTGTAGCGCGCCACCAT

Paste this into a BLAST search page for me
GAGTGCCAGGAGTCAGGGCTTCAATGGGCTTCAATCCACTGTCTGAACAAACAAATCGAGGATTCATTCGCCGCCTTACCGCAGCAGGAGCCCGTGGAAGCGCCGAGGCGGGATCATCTTGATATTATACAGGATCAGGAGCTACTTCACATATGTCATATCAGGCTCCGGAGGCTGCGTAGGCGCGAACCAGTCTGTGACAGTCTGTGAGCTGGACATCCGTGAACATCCGTGATAGTGGTGGCGTCTAGGAGGCGACGACTTCGATCCAAGTGCAACGATCCTCAGCTGGCCTGGAAGGAAGAAGCACAAATCCCATGCCTGAAAGTGCAAGTGTAGCGCGCCACCAT

Full Affymetrix probeset data:

Annotations for 1628895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720