Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628896_a_at:

>probe:Drosophila_2:1628896_a_at:424:375; Interrogation_Position=226; Antisense; GAAGATGAGCAATGGTCCCCAGCTA
>probe:Drosophila_2:1628896_a_at:65:425; Interrogation_Position=270; Antisense; GAGACGCAGGACTCACTGGTGGCCA
>probe:Drosophila_2:1628896_a_at:73:143; Interrogation_Position=332; Antisense; ACTGATCAGGCGATTGGGTACTCCA
>probe:Drosophila_2:1628896_a_at:581:591; Interrogation_Position=346; Antisense; TGGGTACTCCATTTGCTACAAGGCA
>probe:Drosophila_2:1628896_a_at:270:227; Interrogation_Position=365; Antisense; AAGGCATACTCAACGTGGCAGGGAC
>probe:Drosophila_2:1628896_a_at:29:539; Interrogation_Position=390; Antisense; GGTACTTCTTCGTCGAGGACATCTA
>probe:Drosophila_2:1628896_a_at:406:323; Interrogation_Position=441; Antisense; GCGCCGGAAAGCGAATCTTCTTGGA
>probe:Drosophila_2:1628896_a_at:179:645; Interrogation_Position=456; Antisense; TCTTCTTGGAGGTTGCATCGCGGGC
>probe:Drosophila_2:1628896_a_at:54:45; Interrogation_Position=472; Antisense; ATCGCGGGCTGTAGAGCTTCAGTGC
>probe:Drosophila_2:1628896_a_at:42:507; Interrogation_Position=493; Antisense; GTGCCCTCGCCTGGAGTTTAATGTA
>probe:Drosophila_2:1628896_a_at:587:367; Interrogation_Position=526; Antisense; GAATCCTGCACGCAAGTTCTACGAA
>probe:Drosophila_2:1628896_a_at:720:135; Interrogation_Position=546; Antisense; ACGAAAGTCTTGGTGCCGTGGATTT
>probe:Drosophila_2:1628896_a_at:441:171; Interrogation_Position=578; Antisense; AAAGAGGGCTGGCACTACTACCGCG
>probe:Drosophila_2:1628896_a_at:423:161; Interrogation_Position=623; Antisense; AAATTGGCCGCGGATCTGAGGGCAA

Paste this into a BLAST search page for me
GAAGATGAGCAATGGTCCCCAGCTAGAGACGCAGGACTCACTGGTGGCCAACTGATCAGGCGATTGGGTACTCCATGGGTACTCCATTTGCTACAAGGCAAAGGCATACTCAACGTGGCAGGGACGGTACTTCTTCGTCGAGGACATCTAGCGCCGGAAAGCGAATCTTCTTGGATCTTCTTGGAGGTTGCATCGCGGGCATCGCGGGCTGTAGAGCTTCAGTGCGTGCCCTCGCCTGGAGTTTAATGTAGAATCCTGCACGCAAGTTCTACGAAACGAAAGTCTTGGTGCCGTGGATTTAAAGAGGGCTGGCACTACTACCGCGAAATTGGCCGCGGATCTGAGGGCAA

Full Affymetrix probeset data:

Annotations for 1628896_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime