FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628901_at:

>probe:Drosophila_2:1628901_at:730:539; Interrogation_Position=6007; Antisense; GGTTAGCATATGGACTCACTCACGT
>probe:Drosophila_2:1628901_at:336:405; Interrogation_Position=6019; Antisense; GACTCACTCACGTCGGATGACTATA
>probe:Drosophila_2:1628901_at:16:467; Interrogation_Position=6078; Antisense; GATTGGTTCGATTTTGATTACGCGA
>probe:Drosophila_2:1628901_at:180:461; Interrogation_Position=6093; Antisense; GATTACGCGAACTGGATCAATACTT
>probe:Drosophila_2:1628901_at:692:657; Interrogation_Position=6127; Antisense; TAAGCATACTTAAGTTTACCGTGTA
>probe:Drosophila_2:1628901_at:231:475; Interrogation_Position=6172; Antisense; GTATTTTGAAAACGCTTTGGCCCAG
>probe:Drosophila_2:1628901_at:606:581; Interrogation_Position=6189; Antisense; TGGCCCAGCGCTTAGGCTATAATTT
>probe:Drosophila_2:1628901_at:542:481; Interrogation_Position=6231; Antisense; GTATTATCCACCCAAACGATCTAAG
>probe:Drosophila_2:1628901_at:4:199; Interrogation_Position=6245; Antisense; AACGATCTAAGACTCTTCATGCCCA
>probe:Drosophila_2:1628901_at:690:275; Interrogation_Position=6259; Antisense; CTTCATGCCCACATTTCTTTAGCAT
>probe:Drosophila_2:1628901_at:536:473; Interrogation_Position=6312; Antisense; GTAATTGATTTCTAAACGAGACCCT
>probe:Drosophila_2:1628901_at:256:137; Interrogation_Position=6327; Antisense; ACGAGACCCTATATGTTAAGCTAAT
>probe:Drosophila_2:1628901_at:239:327; Interrogation_Position=6478; Antisense; GCGATGGCGATCTAAACTAAATTCA
>probe:Drosophila_2:1628901_at:105:17; Interrogation_Position=6526; Antisense; ATTTTGCTCCTAAATGCACTCACCG

Paste this into a BLAST search page for me
GGTTAGCATATGGACTCACTCACGTGACTCACTCACGTCGGATGACTATAGATTGGTTCGATTTTGATTACGCGAGATTACGCGAACTGGATCAATACTTTAAGCATACTTAAGTTTACCGTGTAGTATTTTGAAAACGCTTTGGCCCAGTGGCCCAGCGCTTAGGCTATAATTTGTATTATCCACCCAAACGATCTAAGAACGATCTAAGACTCTTCATGCCCACTTCATGCCCACATTTCTTTAGCATGTAATTGATTTCTAAACGAGACCCTACGAGACCCTATATGTTAAGCTAATGCGATGGCGATCTAAACTAAATTCAATTTTGCTCCTAAATGCACTCACCG

Full Affymetrix probeset data:

Annotations for 1628901_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720