Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628902_at:

>probe:Drosophila_2:1628902_at:295:15; Interrogation_Position=265; Antisense; ACTTATCAACCGCAAGGCTAAGTTT
>probe:Drosophila_2:1628902_at:566:683; Interrogation_Position=268; Antisense; TATCAACCGCAAGGCTAAGTTTTTC
>probe:Drosophila_2:1628902_at:485:101; Interrogation_Position=275; Antisense; CGCAAGGCTAAGTTTTTCCCGGATG
>probe:Drosophila_2:1628902_at:141:361; Interrogation_Position=276; Antisense; GCAAGGCTAAGTTTTTCCCGGATGC
>probe:Drosophila_2:1628902_at:564:71; Interrogation_Position=279; Antisense; AGGCTAAGTTTTTCCCGGATGCCAG
>probe:Drosophila_2:1628902_at:448:537; Interrogation_Position=280; Antisense; GGCTAAGTTTTTCCCGGATGCCAGC
>probe:Drosophila_2:1628902_at:687:215; Interrogation_Position=284; Antisense; AAGTTTTTCCCGGATGCCAGCACCG
>probe:Drosophila_2:1628902_at:128:113; Interrogation_Position=302; Antisense; AGCACCGCCAACACGTTATTCAATG
>probe:Drosophila_2:1628902_at:187:261; Interrogation_Position=304; Antisense; CACCGCCAACACGTTATTCAATGGA
>probe:Drosophila_2:1628902_at:126:301; Interrogation_Position=307; Antisense; CGCCAACACGTTATTCAATGGAATA
>probe:Drosophila_2:1628902_at:584:9; Interrogation_Position=319; Antisense; ATTCAATGGAATACCCTTCAACGAG
>probe:Drosophila_2:1628902_at:318:227; Interrogation_Position=323; Antisense; AATGGAATACCCTTCAACGAGCTGC
>probe:Drosophila_2:1628902_at:503:65; Interrogation_Position=324; Antisense; ATGGAATACCCTTCAACGAGCTGCC
>probe:Drosophila_2:1628902_at:607:363; Interrogation_Position=327; Antisense; GAATACCCTTCAACGAGCTGCCCAT

Paste this into a BLAST search page for me
ACTTATCAACCGCAAGGCTAAGTTTTATCAACCGCAAGGCTAAGTTTTTCCGCAAGGCTAAGTTTTTCCCGGATGGCAAGGCTAAGTTTTTCCCGGATGCAGGCTAAGTTTTTCCCGGATGCCAGGGCTAAGTTTTTCCCGGATGCCAGCAAGTTTTTCCCGGATGCCAGCACCGAGCACCGCCAACACGTTATTCAATGCACCGCCAACACGTTATTCAATGGACGCCAACACGTTATTCAATGGAATAATTCAATGGAATACCCTTCAACGAGAATGGAATACCCTTCAACGAGCTGCATGGAATACCCTTCAACGAGCTGCCGAATACCCTTCAACGAGCTGCCCAT

Full Affymetrix probeset data:

Annotations for 1628902_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime