FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628905_at:

>probe:Drosophila_2:1628905_at:414:499; Interrogation_Position=132; Antisense; GTCGAGCGAAACTCGGAACTCCGCC
>probe:Drosophila_2:1628905_at:228:413; Interrogation_Position=135; Antisense; GAGCGAAACTCGGAACTCCGCCTTA
>probe:Drosophila_2:1628905_at:625:389; Interrogation_Position=139; Antisense; GAAACTCGGAACTCCGCCTTATCGG
>probe:Drosophila_2:1628905_at:544:381; Interrogation_Position=147; Antisense; GAACTCCGCCTTATCGGGCTCAAAA
>probe:Drosophila_2:1628905_at:172:259; Interrogation_Position=154; Antisense; GCCTTATCGGGCTCAAAAATGACTA
>probe:Drosophila_2:1628905_at:571:181; Interrogation_Position=169; Antisense; AAAATGACTAATCCCTTCCAAGCTT
>probe:Drosophila_2:1628905_at:286:231; Interrogation_Position=171; Antisense; AATGACTAATCCCTTCCAAGCTTTA
>probe:Drosophila_2:1628905_at:439:609; Interrogation_Position=173; Antisense; TGACTAATCCCTTCCAAGCTTTAAT
>probe:Drosophila_2:1628905_at:674:279; Interrogation_Position=176; Antisense; CTAATCCCTTCCAAGCTTTAATCAT
>probe:Drosophila_2:1628905_at:341:45; Interrogation_Position=179; Antisense; ATCCCTTCCAAGCTTTAATCATGTG
>probe:Drosophila_2:1628905_at:204:253; Interrogation_Position=187; Antisense; CAAGCTTTAATCATGTGCGTACCTG
>probe:Drosophila_2:1628905_at:98:343; Interrogation_Position=190; Antisense; GCTTTAATCATGTGCGTACCTGTAG
>probe:Drosophila_2:1628905_at:534:239; Interrogation_Position=195; Antisense; AATCATGTGCGTACCTGTAGAATCC
>probe:Drosophila_2:1628905_at:712:267; Interrogation_Position=198; Antisense; CATGTGCGTACCTGTAGAATCCTAG

Paste this into a BLAST search page for me
GTCGAGCGAAACTCGGAACTCCGCCGAGCGAAACTCGGAACTCCGCCTTAGAAACTCGGAACTCCGCCTTATCGGGAACTCCGCCTTATCGGGCTCAAAAGCCTTATCGGGCTCAAAAATGACTAAAAATGACTAATCCCTTCCAAGCTTAATGACTAATCCCTTCCAAGCTTTATGACTAATCCCTTCCAAGCTTTAATCTAATCCCTTCCAAGCTTTAATCATATCCCTTCCAAGCTTTAATCATGTGCAAGCTTTAATCATGTGCGTACCTGGCTTTAATCATGTGCGTACCTGTAGAATCATGTGCGTACCTGTAGAATCCCATGTGCGTACCTGTAGAATCCTAG

Full Affymetrix probeset data:

Annotations for 1628905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720